Incidental Mutation 'R3617:Ubiad1'
ID268466
Institutional Source Beutler Lab
Gene Symbol Ubiad1
Ensembl Gene ENSMUSG00000047719
Gene NameUbiA prenyltransferase domain containing 1
SynonymsTere1, 1200002M06Rik
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148434495-148444771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148436360 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 269 (I269T)
Ref Sequence ENSEMBL: ENSMUSP00000058502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051633]
Predicted Effect probably benign
Transcript: ENSMUST00000051633
AA Change: I269T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000058502
Gene: ENSMUSG00000047719
AA Change: I269T

DomainStartEndE-ValueType
Pfam:UbiA 59 324 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156686
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein thought to be involved in cholesterol and phospholipid metabolism. Mutations in this gene are associated with Schnyder crystalline corneal dystrophy. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, reduced embryo size, failure to form the primitive streak, no mesoderm and inability to synthesize menaquinone 4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Ubiad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Ubiad1 APN 4 148436357 missense probably benign 0.33
IGL02260:Ubiad1 APN 4 148444107 missense probably benign 0.23
R1935:Ubiad1 UTSW 4 148444011 missense probably damaging 1.00
R1936:Ubiad1 UTSW 4 148444011 missense probably damaging 1.00
R1937:Ubiad1 UTSW 4 148444011 missense probably damaging 1.00
R1939:Ubiad1 UTSW 4 148444011 missense probably damaging 1.00
R1940:Ubiad1 UTSW 4 148444011 missense probably damaging 1.00
R4873:Ubiad1 UTSW 4 148444099 missense possibly damaging 0.91
R4875:Ubiad1 UTSW 4 148444099 missense possibly damaging 0.91
R5284:Ubiad1 UTSW 4 148436498 missense probably damaging 1.00
R5343:Ubiad1 UTSW 4 148436435 missense possibly damaging 0.90
R6271:Ubiad1 UTSW 4 148436626 nonsense probably null
R6467:Ubiad1 UTSW 4 148436225 missense possibly damaging 0.46
R6929:Ubiad1 UTSW 4 148444122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGGTCTCCTCAGAGTC -3'
(R):5'- TGTTTGCCTACGCTGTCCAG -3'

Sequencing Primer
(F):5'- TCTCCTCAGAGTCTGGGCAG -3'
(R):5'- GTGGGATCCCTGGCCATCTTC -3'
Posted On2015-02-19