Mutagenetix > Incidental Mutations

Incidental Mutation 'R3617:Slc4a4'

268468

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

040674-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89234804 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1036 (D1036G)

Ref Sequence

ENSEMBL: ENSMUSP00000121744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

silent
Transcript: ENSMUST00000113218

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000130041

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000148750

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156238
AA Change: D1036G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: D1036G

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0935

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,679,289	V460A	probably damaging	Het
Aplf	T	C	6: 87,671,883	I25V	possibly damaging	Het
Ascc3	A	G	10: 50,618,185	T239A	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Cbfa2t2	A	T	2: 154,436,984		probably benign	Het
Cdkn1c	C	T	7: 143,459,794		probably benign	Het
Cfap46	A	G	7: 139,639,599	S1317P	probably benign	Het
Cntln	C	T	4: 85,004,977	Q560*	probably null	Het
Cntn2	G	C	1: 132,528,623	A161G	probably benign	Het
Crybg1	A	G	10: 43,956,786	I1991T	possibly damaging	Het
Cttnbp2	T	C	6: 18,414,190	E952G	probably damaging	Het
Dhx36	T	C	3: 62,472,007	T887A	possibly damaging	Het
Dhx36	A	G	3: 62,487,060	F512L	probably benign	Het
Fthl17f	A	G	X: 9,063,623	T153A	probably benign	Het
Gad1-ps	T	A	10: 99,445,398		noncoding transcript	Het
Gba2	C	T	4: 43,573,803	R163H	probably damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gm17019	A	T	5: 15,031,067	M120K	possibly damaging	Het
Gm8251	T	C	1: 44,060,954	D328G	probably benign	Het
Helz2	C	T	2: 181,233,061	R1880H	probably damaging	Het
Ifi204	T	C	1: 173,755,717	I312V	possibly damaging	Het
Kncn	T	C	4: 115,885,892	F55L	probably benign	Het
Kndc1	G	A	7: 139,902,060		probably benign	Het
Nat8f3	C	A	6: 85,761,688	A31S	probably benign	Het
Ndst4	T	C	3: 125,438,133	I117T	probably benign	Het
Ndufa9	G	T	6: 126,849,108		probably benign	Het
Nupl2	T	C	5: 24,182,327	S372P	probably benign	Het
Pde6a	A	G	18: 61,231,503		probably benign	Het
Pigw	T	C	11: 84,878,307	I65M	probably damaging	Het
Pip	A	G	6: 41,851,937	T139A	probably benign	Het
Rel	A	T	11: 23,745,780	D202E	probably damaging	Het
Rhot2	A	G	17: 25,840,981		probably benign	Het
Sh3rf3	G	A	10: 59,086,863	R587Q	possibly damaging	Het
Sim1	T	A	10: 50,909,528	M231K	probably damaging	Het
Slc12a9	G	A	5: 137,332,497	T47M	probably damaging	Het
Tas2r143	A	T	6: 42,401,063	I276F	probably benign	Het
Tgfbr3	A	T	5: 107,140,619	F392Y	possibly damaging	Het
Tmem266	T	C	9: 55,400,634	V148A	probably damaging	Het
Ubiad1	A	G	4: 148,436,360	I269T	probably benign	Het
Vwc2l	A	G	1: 70,728,882		probably null	Het
Zbtb49	G	A	5: 38,200,631		probably benign	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	synonymous	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ATCCATCGCCACATGCTTAC -3'
(R):5'- TGCTCTCCATCAGCAAAGCC -3'

Sequencing Primer
(F):5'- CACATGCTTACCTCGATACAATGTTG -3'
(R):5'- TCAGCAAAGCCTGGGTGAGTC -3'

Posted On

2015-02-19