Incidental Mutation 'R3617:Tgfbr3'
ID268469
Institutional Source Beutler Lab
Gene Symbol Tgfbr3
Ensembl Gene ENSMUSG00000029287
Gene Nametransforming growth factor, beta receptor III
Synonymsbetaglycan, TBRIII, 1110036H20Rik
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107106570-107289629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107140619 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 392 (F392Y)
Ref Sequence ENSEMBL: ENSMUSP00000031224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031224
AA Change: F392Y

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287
AA Change: F392Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
internal_repeat_1 64 193 2.48e-5 PROSPERO
internal_repeat_1 232 361 2.48e-5 PROSPERO
low complexity region 419 430 N/A INTRINSIC
ZP 454 731 8.12e-65 SMART
transmembrane domain 786 808 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199780
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Tgfbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tgfbr3 APN 5 107142501 missense probably benign 0.00
IGL01135:Tgfbr3 APN 5 107215028 missense probably damaging 1.00
IGL01375:Tgfbr3 APN 5 107136971 missense probably benign
IGL01457:Tgfbr3 APN 5 107149898 missense probably damaging 1.00
IGL01599:Tgfbr3 APN 5 107118451 missense probably damaging 0.98
IGL01646:Tgfbr3 APN 5 107121413 splice site probably benign
IGL01945:Tgfbr3 APN 5 107121358 critical splice donor site probably null
IGL03039:Tgfbr3 APN 5 107177799 splice site probably benign
IGL03202:Tgfbr3 APN 5 107109764 splice site probably benign
IGL03378:Tgfbr3 APN 5 107109702 missense probably damaging 1.00
R0131:Tgfbr3 UTSW 5 107132816 missense probably benign 0.00
R0452:Tgfbr3 UTSW 5 107140423 missense probably benign 0.00
R0665:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0667:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0751:Tgfbr3 UTSW 5 107139883 missense probably damaging 1.00
R1373:Tgfbr3 UTSW 5 107214943 missense probably benign 0.01
R1777:Tgfbr3 UTSW 5 107136930 missense probably benign 0.31
R1887:Tgfbr3 UTSW 5 107137008 missense probably damaging 1.00
R3019:Tgfbr3 UTSW 5 107137546 missense possibly damaging 0.70
R3552:Tgfbr3 UTSW 5 107139839 missense probably damaging 0.99
R3901:Tgfbr3 UTSW 5 107214887 splice site probably benign
R4830:Tgfbr3 UTSW 5 107109719 missense probably damaging 1.00
R4939:Tgfbr3 UTSW 5 107130469 missense probably benign
R5020:Tgfbr3 UTSW 5 107214970 missense probably damaging 1.00
R5044:Tgfbr3 UTSW 5 107136929 missense possibly damaging 0.88
R5619:Tgfbr3 UTSW 5 107140514 missense probably benign 0.23
R5752:Tgfbr3 UTSW 5 107139807 missense probably benign 0.01
R5768:Tgfbr3 UTSW 5 107149895 missense probably benign
R5799:Tgfbr3 UTSW 5 107109608 utr 3 prime probably benign
R5818:Tgfbr3 UTSW 5 107133003 missense probably benign
R5846:Tgfbr3 UTSW 5 107140655 missense possibly damaging 0.51
R5859:Tgfbr3 UTSW 5 107140515 missense probably benign 0.00
R6049:Tgfbr3 UTSW 5 107118485 missense probably damaging 0.99
R6378:Tgfbr3 UTSW 5 107177813 missense probably benign 0.00
R6696:Tgfbr3 UTSW 5 107136930 missense probably benign 0.02
R6823:Tgfbr3 UTSW 5 107149914 missense probably damaging 1.00
R6994:Tgfbr3 UTSW 5 107133026 missense probably damaging 1.00
R7454:Tgfbr3 UTSW 5 107215028 missense probably damaging 1.00
R7773:Tgfbr3 UTSW 5 107140502 missense probably benign 0.00
X0022:Tgfbr3 UTSW 5 107136926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGCACTGACCTGGAAAG -3'
(R):5'- ATCAGTCACTCATGATGTTCTCAC -3'

Sequencing Primer
(F):5'- TCACATTTGACTGACAGGGC -3'
(R):5'- GATGTTCTCACAATGACCGTGAC -3'
Posted On2015-02-19