Incidental Mutation 'R3617:Tmem266'
ID268480
Institutional Source Beutler Lab
Gene Symbol Tmem266
Ensembl Gene ENSMUSG00000032313
Gene Nametransmembrane protein 266
SynonymsAI118078
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location55326913-55438345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55400634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000034862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034862] [ENSMUST00000085754]
Predicted Effect probably damaging
Transcript: ENSMUST00000034862
AA Change: V148A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034862
Gene: ENSMUSG00000032313
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
low complexity region 260 283 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 423 439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085754
AA Change: V83A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082906
Gene: ENSMUSG00000032313
AA Change: V83A

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 195 218 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130465
Meta Mutation Damage Score 0.1495 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Tmem266
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Tmem266 APN 9 55435202 missense probably benign 0.12
IGL03366:Tmem266 APN 9 55437233 missense probably benign 0.06
R0088:Tmem266 UTSW 9 55437329 missense probably damaging 1.00
R0418:Tmem266 UTSW 9 55437413 missense probably benign 0.06
R0497:Tmem266 UTSW 9 55380884 intron probably null
R0763:Tmem266 UTSW 9 55414955 missense probably damaging 1.00
R1657:Tmem266 UTSW 9 55418008 missense probably damaging 1.00
R4235:Tmem266 UTSW 9 55418107 missense probably damaging 0.99
R4767:Tmem266 UTSW 9 55380741 missense probably damaging 1.00
R5587:Tmem266 UTSW 9 55437566 missense probably damaging 1.00
R5732:Tmem266 UTSW 9 55380836 missense probably damaging 1.00
R5783:Tmem266 UTSW 9 55397803 missense probably damaging 1.00
R6193:Tmem266 UTSW 9 55437209 missense probably benign 0.01
R6943:Tmem266 UTSW 9 55377567 start gained probably benign
R7459:Tmem266 UTSW 9 55396599 missense unknown
X0063:Tmem266 UTSW 9 55380749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGTTCTAACTCTCTGACCCAG -3'
(R):5'- TGCATGTATGTGTCTGTGAACAC -3'

Sequencing Primer
(F):5'- TGGTTTCCACAAGCACCCAG -3'
(R):5'- ATGTATGTGTCTGTGAACACTTCTTG -3'
Posted On2015-02-19