Incidental Mutation 'R3617:Gad1-ps'
ID268485
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Nameglutamate decarboxylase 1, pseudogene
SynonymsGad-1ps
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99443838-99447029 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 99445398 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.3591 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99445448 exon noncoding transcript
IGL01301:Gad1-ps APN 10 99445151 exon noncoding transcript
IGL01394:Gad1-ps APN 10 99445562 exon noncoding transcript
IGL02220:Gad1-ps APN 10 99445322 exon noncoding transcript
IGL02240:Gad1-ps APN 10 99444958 exon noncoding transcript
IGL03406:Gad1-ps APN 10 99444779 exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99445151 exon noncoding transcript
R0305:Gad1-ps UTSW 10 99444803 exon noncoding transcript
R0446:Gad1-ps UTSW 10 99445521 exon noncoding transcript
R0538:Gad1-ps UTSW 10 99444992 exon noncoding transcript
R1511:Gad1-ps UTSW 10 99445469 exon noncoding transcript
R1734:Gad1-ps UTSW 10 99445775 exon noncoding transcript
R1745:Gad1-ps UTSW 10 99445524 exon noncoding transcript
R1886:Gad1-ps UTSW 10 99445582 exon noncoding transcript
R3111:Gad1-ps UTSW 10 99444521 exon noncoding transcript
R5042:Gad1-ps UTSW 10 99445654 exon noncoding transcript
R5223:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5234:Gad1-ps UTSW 10 99445326 exon noncoding transcript
R5275:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5295:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5334:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5335:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5336:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5337:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5396:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5397:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5399:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5428:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5429:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5431:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5661:Gad1-ps UTSW 10 99445039 exon noncoding transcript
R5667:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5671:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5885:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5886:Gad1-ps UTSW 10 99445147 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGCTCATGTCCCAGAAGCAC -3'
(R):5'- ACATTTGTGTGCTCAGGCTC -3'

Sequencing Primer
(F):5'- AAAGGGCCGATTCAGTCACCTG -3'
(R):5'- TGTGCTCAGGCTCACCATCG -3'
Posted On2015-02-19