Mutagenetix > Incidental Mutations

Incidental Mutation 'R3617:Gad1-ps'

268485

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

040674-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R3617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 99445398 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Meta Mutation Damage Score

0.3591

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,679,289	V460A	probably damaging	Het
Aplf	T	C	6: 87,671,883	I25V	possibly damaging	Het
Ascc3	A	G	10: 50,618,185	T239A	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Cbfa2t2	A	T	2: 154,436,984		probably benign	Het
Cdkn1c	C	T	7: 143,459,794		probably benign	Het
Cfap46	A	G	7: 139,639,599	S1317P	probably benign	Het
Cntln	C	T	4: 85,004,977	Q560*	probably null	Het
Cntn2	G	C	1: 132,528,623	A161G	probably benign	Het
Crybg1	A	G	10: 43,956,786	I1991T	possibly damaging	Het
Cttnbp2	T	C	6: 18,414,190	E952G	probably damaging	Het
Dhx36	T	C	3: 62,472,007	T887A	possibly damaging	Het
Dhx36	A	G	3: 62,487,060	F512L	probably benign	Het
Fthl17f	A	G	X: 9,063,623	T153A	probably benign	Het
Gba2	C	T	4: 43,573,803	R163H	probably damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gm17019	A	T	5: 15,031,067	M120K	possibly damaging	Het
Gm8251	T	C	1: 44,060,954	D328G	probably benign	Het
Helz2	C	T	2: 181,233,061	R1880H	probably damaging	Het
Ifi204	T	C	1: 173,755,717	I312V	possibly damaging	Het
Kncn	T	C	4: 115,885,892	F55L	probably benign	Het
Kndc1	G	A	7: 139,902,060		probably benign	Het
Nat8f3	C	A	6: 85,761,688	A31S	probably benign	Het
Ndst4	T	C	3: 125,438,133	I117T	probably benign	Het
Ndufa9	G	T	6: 126,849,108		probably benign	Het
Nupl2	T	C	5: 24,182,327	S372P	probably benign	Het
Pde6a	A	G	18: 61,231,503		probably benign	Het
Pigw	T	C	11: 84,878,307	I65M	probably damaging	Het
Pip	A	G	6: 41,851,937	T139A	probably benign	Het
Rel	A	T	11: 23,745,780	D202E	probably damaging	Het
Rhot2	A	G	17: 25,840,981		probably benign	Het
Sh3rf3	G	A	10: 59,086,863	R587Q	possibly damaging	Het
Sim1	T	A	10: 50,909,528	M231K	probably damaging	Het
Slc12a9	G	A	5: 137,332,497	T47M	probably damaging	Het
Slc4a4	A	G	5: 89,234,804	D1036G	probably benign	Het
Tas2r143	A	T	6: 42,401,063	I276F	probably benign	Het
Tgfbr3	A	T	5: 107,140,619	F392Y	possibly damaging	Het
Tmem266	T	C	9: 55,400,634	V148A	probably damaging	Het
Ubiad1	A	G	4: 148,436,360	I269T	probably benign	Het
Vwc2l	A	G	1: 70,728,882		probably null	Het
Zbtb49	G	A	5: 38,200,631		probably benign	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0305:Gad1-ps	UTSW	10	99444803	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5223:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5295:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5335:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5429:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGCTCATGTCCCAGAAGCAC -3'
(R):5'- ACATTTGTGTGCTCAGGCTC -3'

Sequencing Primer
(F):5'- AAAGGGCCGATTCAGTCACCTG -3'
(R):5'- TGTGCTCAGGCTCACCATCG -3'

Posted On

2015-02-19