Mutagenetix > Incidental Mutation

Incidental Mutation 'R3618:Ino80'

268500

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

040675-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3618 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119446872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 374 (D374G)

Ref Sequence

ENSEMBL: ENSMUSP00000106431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

probably null
Transcript: ENSMUST00000049920
AA Change: D374G

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D374G

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110808
AA Change: D374G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: D374G

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,407	E1119G	probably damaging	Het
5730559C18Rik	A	C	1: 136,214,372	V663G	probably benign	Het
Ahnak2	A	G	12: 112,786,222	I132T	probably damaging	Het
Arhgap29	G	A	3: 121,988,527	D63N	possibly damaging	Het
Bsn	T	A	9: 108,117,561		probably null	Het
Cfap161	A	C	7: 83,780,182	Y209*	probably null	Het
Drp2	A	C	X: 134,439,968	D458A	probably benign	Het
Efcab6	T	C	15: 83,950,069	H446R	probably benign	Het
Enpep	G	C	3: 129,284,158	S603R	possibly damaging	Het
F13a1	G	A	13: 36,943,993	T337I	probably damaging	Het
Fhod3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGA	18: 25,020,665		probably benign	Het
Hcfc1	A	T	X: 73,950,088	V1157D	probably benign	Het
Kif1a	T	C	1: 93,077,043	E143G	probably null	Het
Larp1	A	T	11: 58,057,346	E990D	probably benign	Het
Larp7	C	A	3: 127,536,965	E568*	probably null	Het
Ltn1	A	T	16: 87,420,899	S298R	probably damaging	Het
Mcm10	A	G	2: 4,997,102		probably null	Het
Mef2a	G	A	7: 67,268,327	S111L	probably benign	Het
Mroh1	A	G	15: 76,452,346	T1590A	possibly damaging	Het
Ncoa6	A	T	2: 155,407,789	H1198Q	possibly damaging	Het
Ogg1	A	G	6: 113,328,373	E49G	probably damaging	Het
Palm3	T	A	8: 84,029,344	V495E	probably benign	Het
Pam	A	G	1: 97,834,432	F809L	probably damaging	Het
Parp3	T	C	9: 106,475,063	E88G	possibly damaging	Het
Ptprs	A	G	17: 56,428,965	I156T	probably benign	Het
Pus7l	T	A	15: 94,527,907	I538F	probably damaging	Het
Rgs8	A	G	1: 153,690,996	T98A	probably null	Het
Ryr2	C	T	13: 11,772,580		probably null	Het
Slc8a2	A	G	7: 16,152,899	N656D	possibly damaging	Het
Stard9	C	T	2: 120,699,019	T1919I	possibly damaging	Het
Tbcel	T	C	9: 42,461,295		probably benign	Het
Trpv3	A	T	11: 73,295,455	I691F	probably damaging	Het
Uba2	A	G	7: 34,154,482		probably null	Het
Usp53	A	C	3: 122,934,412	S840R	probably benign	Het
Vmn2r100	A	T	17: 19,523,430	I452F	probably benign	Het
Zbtb48	A	T	4: 152,026,027		probably null	Het
Zfp385b	G	A	2: 77,415,889	P177S	probably benign	Het
Zfp42	T	C	8: 43,295,901	R188G	possibly damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTAGTGCTTTGGTACTAAATAGAGG -3'
(R):5'- CTTGCCCATCAATGCATGAAGG -3'

Sequencing Primer
(F):5'- GTTCCAGGATAGCTGGACTACAC -3'
(R):5'- TGCATGAAGGAGGTGCGTC -3'

Posted On

2015-02-19