Incidental Mutation 'R3618:Pus7l'
ID268531
Institutional Source Beutler Lab
Gene Symbol Pus7l
Ensembl Gene ENSMUSG00000033356
Gene Namepseudouridylate synthase 7-like
Synonyms
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94522688-94543547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94527907 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 538 (I538F)
Ref Sequence ENSEMBL: ENSMUSP00000044075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049151]
Predicted Effect probably damaging
Transcript: ENSMUST00000049151
AA Change: I538F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044075
Gene: ENSMUSG00000033356
AA Change: I538F

DomainStartEndE-ValueType
Pfam:TruD 280 697 1e-70 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Pus7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Pus7l APN 15 94531612 missense probably benign 0.07
IGL02049:Pus7l APN 15 94540178 missense probably damaging 1.00
IGL02484:Pus7l APN 15 94529488 missense possibly damaging 0.70
IGL02731:Pus7l APN 15 94523464 missense probably benign 0.03
IGL03252:Pus7l APN 15 94525810 missense probably benign 0.00
IGL03392:Pus7l APN 15 94536568 missense probably damaging 1.00
R0638:Pus7l UTSW 15 94523417 missense probably benign 0.20
R0848:Pus7l UTSW 15 94540512 missense probably benign 0.16
R1646:Pus7l UTSW 15 94533636 missense probably benign 0.33
R1785:Pus7l UTSW 15 94540637 missense probably benign 0.04
R2046:Pus7l UTSW 15 94540785 missense probably benign 0.01
R2206:Pus7l UTSW 15 94523590 missense probably damaging 1.00
R2210:Pus7l UTSW 15 94540292 missense possibly damaging 0.95
R4485:Pus7l UTSW 15 94523490 missense probably benign 0.00
R4487:Pus7l UTSW 15 94531617 missense possibly damaging 0.46
R4686:Pus7l UTSW 15 94540211 missense probably damaging 1.00
R4739:Pus7l UTSW 15 94540710 missense probably benign 0.02
R4975:Pus7l UTSW 15 94529488 missense possibly damaging 0.70
R5431:Pus7l UTSW 15 94529486 missense probably damaging 1.00
R5567:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5570:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5896:Pus7l UTSW 15 94529451 splice site probably null
R6408:Pus7l UTSW 15 94531575 missense probably benign 0.06
R6681:Pus7l UTSW 15 94527865 missense probably benign 0.00
R7344:Pus7l UTSW 15 94540617 missense probably benign 0.01
R7811:Pus7l UTSW 15 94540826 missense probably damaging 1.00
X0065:Pus7l UTSW 15 94540773 missense possibly damaging 0.87
X0066:Pus7l UTSW 15 94529493 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCTCAGTGGTCAGAAGGAGTC -3'
(R):5'- TGGAAAGGCATCCCACAAGC -3'

Sequencing Primer
(F):5'- GGAGTCAAGCAAACAGAGTTACCATC -3'
(R):5'- GTTCTTCATTTCAGAGGATGCCAAAG -3'
Posted On2015-02-19