Incidental Mutation 'R3618:Ptprs'
ID268534
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56428965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 156 (I156T)
Ref Sequence ENSEMBL: ENSMUSP00000153398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223642] [ENSMUST00000223859] [ENSMUST00000225456]
Predicted Effect probably benign
Transcript: ENSMUST00000067538
AA Change: I668T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: I668T

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086828
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143018
Predicted Effect probably benign
Transcript: ENSMUST00000223642
AA Change: I103T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223783
Predicted Effect probably benign
Transcript: ENSMUST00000223859
Predicted Effect probably benign
Transcript: ENSMUST00000224777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225104
Predicted Effect probably benign
Transcript: ENSMUST00000225456
AA Change: I156T

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225785
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
R7851:Ptprs UTSW 17 56425482 missense probably benign
R7903:Ptprs UTSW 17 56424960 nonsense probably null
R7934:Ptprs UTSW 17 56425482 missense probably benign
R7986:Ptprs UTSW 17 56424960 nonsense probably null
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGACTCAGGAGGCCACCTAC -3'
(R):5'- CGTTAAGTGCACCAGCTTGC -3'

Sequencing Primer
(F):5'- AACTTCGAGGCCAGCTTG -3'
(R):5'- CGCTCCACGGCCATATTG -3'
Posted On2015-02-19