Incidental Mutation 'R3619:Olfr510'
ID268561
Institutional Source Beutler Lab
Gene Symbol Olfr510
Ensembl Gene ENSMUSG00000096209
Gene Nameolfactory receptor 510
SynonymsMOR204-34, GA_x6K02T2PBJ9-10997715-10998659
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108666418-108670259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108667850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 145 (I145F)
Ref Sequence ENSEMBL: ENSMUSP00000149693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076289] [ENSMUST00000213979] [ENSMUST00000216331] [ENSMUST00000217170]
Predicted Effect probably benign
Transcript: ENSMUST00000076289
AA Change: I145F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075637
Gene: ENSMUSG00000096209
AA Change: I145F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210621
AA Change: I145F
Predicted Effect probably benign
Transcript: ENSMUST00000213979
AA Change: I145F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216331
AA Change: I145F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217170
AA Change: I145F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Olfr510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Olfr510 APN 7 108667700 missense possibly damaging 0.61
IGL00952:Olfr510 APN 7 108668238 missense possibly damaging 0.89
IGL01358:Olfr510 APN 7 108667662 missense possibly damaging 0.90
IGL01663:Olfr510 APN 7 108667891 missense probably benign 0.01
IGL02686:Olfr510 APN 7 108667886 missense probably benign 0.00
PIT4466001:Olfr510 UTSW 7 108667536 missense possibly damaging 0.52
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0792:Olfr510 UTSW 7 108668157 missense probably damaging 1.00
R0925:Olfr510 UTSW 7 108668193 missense probably benign 0.00
R1829:Olfr510 UTSW 7 108667644 missense probably benign 0.24
R2092:Olfr510 UTSW 7 108667662 frame shift probably null
R2483:Olfr510 UTSW 7 108667662 frame shift probably null
R4386:Olfr510 UTSW 7 108668253 missense probably damaging 0.99
R5298:Olfr510 UTSW 7 108668072 missense probably benign 0.00
R5622:Olfr510 UTSW 7 108668082 missense probably benign
R6079:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R6138:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R8359:Olfr510 UTSW 7 108668311 missense probably benign 0.00
U15987:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
Z1177:Olfr510 UTSW 7 108667836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTTCCTGGTGGAGAGG -3'
(R):5'- CTCAGTGGAATGCATCTTCAGG -3'

Sequencing Primer
(F):5'- GGAGCAGTATATCCTACATTGGG -3'
(R):5'- CACTGTGATTACAATAATAGTGCCAG -3'
Posted On2015-02-19