Incidental Mutation 'R3619:Ccdc82'
ID268564
Institutional Source Beutler Lab
Gene Symbol Ccdc82
Ensembl Gene ENSMUSG00000079084
Gene Namecoiled-coil domain containing 82
Synonyms
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13246955-13292520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13252306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 74 (D74E)
Ref Sequence ENSEMBL: ENSMUSP00000150947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110583] [ENSMUST00000216578] [ENSMUST00000217444]
Predicted Effect probably benign
Transcript: ENSMUST00000110583
AA Change: D74E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084
AA Change: D74E

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 1.8e-50 PFAM
low complexity region 218 231 N/A INTRINSIC
Pfam:DUF4211 273 432 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169961
SMART Domains Protein: ENSMUSP00000126058
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 2.2e-55 PFAM
low complexity region 218 231 N/A INTRINSIC
low complexity region 250 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215735
Predicted Effect probably benign
Transcript: ENSMUST00000216578
AA Change: D74E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217444
AA Change: D74E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Ccdc82
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1276:Ccdc82 UTSW 9 13281413 missense probably benign 0.03
R1580:Ccdc82 UTSW 9 13252760 missense probably damaging 1.00
R1662:Ccdc82 UTSW 9 13262772 missense probably damaging 1.00
R3858:Ccdc82 UTSW 9 13252079 start gained probably benign
R3963:Ccdc82 UTSW 9 13252386 missense possibly damaging 0.78
R4287:Ccdc82 UTSW 9 13253418 missense probably benign 0.13
R4674:Ccdc82 UTSW 9 13252635 missense probably benign 0.45
R5591:Ccdc82 UTSW 9 13272503 critical splice donor site probably null
R6122:Ccdc82 UTSW 9 13266412 missense probably benign 0.01
R6175:Ccdc82 UTSW 9 13272479 missense probably damaging 1.00
R6434:Ccdc82 UTSW 9 13252034 intron probably benign
R6457:Ccdc82 UTSW 9 13272426 missense possibly damaging 0.73
R6825:Ccdc82 UTSW 9 13251976 intron probably benign
R7191:Ccdc82 UTSW 9 13252472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTACATGTTAGAAGACACGAAAC -3'
(R):5'- TGTGATGATTCTCTGCTTGACC -3'

Sequencing Primer
(F):5'- AAATTCTAAAACCCAAAAACCTGAAC -3'
(R):5'- TGACCAGGGTGAGCTTCATCATC -3'
Posted On2015-02-19