Incidental Mutation 'R3619:Micu1'
ID268566
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Namemitochondrial calcium uptake 1
SynonymsC730016L05Rik, Cbara1
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location59702477-59864132 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 59768258 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000171409] [ENSMUST00000179709]
Predicted Effect probably null
Transcript: ENSMUST00000020311
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020311
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092508
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165563
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171409
SMART Domains Protein: ENSMUSP00000131000
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 61 N/A INTRINSIC
Pfam:EF-hand_6 191 221 1.8e-6 PFAM
Pfam:EF-hand_5 192 216 5.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172034
Predicted Effect probably null
Transcript: ENSMUST00000179709
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59863278 missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59839736 missense probably damaging 1.00
IGL03183:Micu1 APN 10 59728048 nonsense probably null
R0025:Micu1 UTSW 10 59788877 critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59839681 missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59756727 intron probably benign
R1121:Micu1 UTSW 10 59788982 missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59788976 missense probably damaging 1.00
R1762:Micu1 UTSW 10 59863260 missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59733161 splice site probably benign
R1976:Micu1 UTSW 10 59768213 missense probably damaging 1.00
R2082:Micu1 UTSW 10 59863307 missense probably benign 0.00
R2152:Micu1 UTSW 10 59863288 missense probably benign 0.01
R2395:Micu1 UTSW 10 59863202 nonsense probably null
R3953:Micu1 UTSW 10 59750504 missense probably benign 0.01
R4809:Micu1 UTSW 10 59740822 missense probably benign
R4948:Micu1 UTSW 10 59863254 missense possibly damaging 0.56
R5103:Micu1 UTSW 10 59788984 missense possibly damaging 0.79
R5137:Micu1 UTSW 10 59827232 missense probably benign 0.20
R5431:Micu1 UTSW 10 59750521 missense possibly damaging 0.92
R5805:Micu1 UTSW 10 59827306 missense possibly damaging 0.46
R6910:Micu1 UTSW 10 59740667 missense probably damaging 1.00
R7030:Micu1 UTSW 10 59789021 missense possibly damaging 0.92
R7845:Micu1 UTSW 10 59839785 critical splice donor site probably null
Z1177:Micu1 UTSW 10 59728041 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGGCCGTCCTAGAAGTG -3'
(R):5'- TCCTTTCAAGAGAGTTTACACCC -3'

Sequencing Primer
(F):5'- AACTGGGATAAATGTCGTCCGTTC -3'
(R):5'- GAGAGTTTACACCCAAATTACAGAAG -3'
Posted On2015-02-19