Incidental Mutation 'R3619:Hnrnpab'
ID268569
Institutional Source Beutler Lab
Gene Symbol Hnrnpab
Ensembl Gene ENSMUSG00000020358
Gene Nameheterogeneous nuclear ribonucleoprotein A/B
SynonymsCBF-A, Hnrpab, Cgbfa
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51600100-51606847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51602611 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 257 (N257D)
Ref Sequence ENSEMBL: ENSMUSP00000074238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020625] [ENSMUST00000074669] [ENSMUST00000101249] [ENSMUST00000101250] [ENSMUST00000109103] [ENSMUST00000167797]
Predicted Effect probably benign
Transcript: ENSMUST00000020625
SMART Domains Protein: ENSMUSP00000020625
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 27 433 2.1e-81 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074669
AA Change: N257D

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074238
Gene: ENSMUSG00000020358
AA Change: N257D

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 270 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101249
AA Change: N257D
SMART Domains Protein: ENSMUSP00000098807
Gene: ENSMUSG00000020358
AA Change: N257D

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101250
SMART Domains Protein: ENSMUSP00000098808
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 212 8.2e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109103
AA Change: N257D
SMART Domains Protein: ENSMUSP00000104731
Gene: ENSMUSG00000020358
AA Change: N257D

DomainStartEndE-ValueType
Pfam:CBFNT 1 75 5.7e-23 PFAM
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167797
SMART Domains Protein: ENSMUSP00000132190
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 373 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169995
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with consensus RNA binding domains present in a number of other RNA binding proteins and a glycine-rich C-terminus. This gene overlaps in a tail-to-tail orientation the gene encoding alanine-glyoxylate aminotransferase 2-like 2. Some of the exons of this gene are interspersed with exons of alanine-glyoxylate aminotransferase 2-like 2. Two alternatively spliced transcript variants that encode distinct proteins have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron differentiation, increased susceptibility to neuronal excitotoxicity and long neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably damaging Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Hnrnpab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Hnrnpab APN 11 51601795 intron probably benign
IGL02806:Hnrnpab APN 11 51605478 missense probably benign 0.03
F5770:Hnrnpab UTSW 11 51602624 missense probably benign 0.39
R0172:Hnrnpab UTSW 11 51602667 missense probably damaging 0.99
R3747:Hnrnpab UTSW 11 51602646 missense probably benign 0.04
R5489:Hnrnpab UTSW 11 51604813 missense probably damaging 1.00
R5854:Hnrnpab UTSW 11 51604681 missense probably damaging 1.00
R5910:Hnrnpab UTSW 11 51601454 missense probably benign
R6901:Hnrnpab UTSW 11 51601848 intron probably benign
R7652:Hnrnpab UTSW 11 51605573 missense probably damaging 0.99
R7766:Hnrnpab UTSW 11 51601466 missense unknown
V7581:Hnrnpab UTSW 11 51602624 missense probably benign 0.39
V7583:Hnrnpab UTSW 11 51602624 missense probably benign 0.39
X0025:Hnrnpab UTSW 11 51604729 missense probably damaging 1.00
X0064:Hnrnpab UTSW 11 51601801 intron probably benign
Z1088:Hnrnpab UTSW 11 51601746 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCCATAGCAGCACAAGC -3'
(R):5'- AAGGTGGGTGTCAATCTTGC -3'

Sequencing Primer
(F):5'- GCCATAGCAGCACAAGCATACAG -3'
(R):5'- GTAGGATGAGTATCTTCTGTGAAAAG -3'
Posted On2015-02-19