Incidental Mutation 'R3619:Gnmt'
ID268576
Institutional Source Beutler Lab
Gene Symbol Gnmt
Ensembl Gene ENSMUSG00000002769
Gene Nameglycine N-methyltransferase
Synonymsglycine N methyl transferase
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R3619 (G1)
Quality Score196
Status Not validated
Chromosome17
Chromosomal Location46725664-46729168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46729037 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 39 (R39C)
Ref Sequence ENSEMBL: ENSMUSP00000002846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
PDB Structure
Crystal Structure of Mouse Glycine N-Methyltransferase (Tetragonal Form) [X-RAY DIFFRACTION]
Crystal Structure of Mouse Glycine N-Methyltransferase (Monoclinic Form) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000002846
AA Change: R39C

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769
AA Change: R39C

DomainStartEndE-ValueType
Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display elevated levels of methionine and S-adenosylmethionine in the liver. Mice homozygous for another null allele exhibit hepatitis, increased hepatic glycogen storage, and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably damaging Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Gnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gnmt APN 17 46726680 missense probably benign 0.28
health_nut UTSW 17 46726345 missense probably damaging 1.00
impulsive UTSW 17 46725966 missense probably damaging 1.00
rash UTSW 17 46725736 utr 3 prime probably benign
R0480:Gnmt UTSW 17 46725928 missense probably benign 0.06
R0938:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0939:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0940:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0941:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R4173:Gnmt UTSW 17 46726121 missense probably damaging 1.00
R4456:Gnmt UTSW 17 46728984 missense probably benign 0.07
R4498:Gnmt UTSW 17 46725736 utr 3 prime probably benign
R4659:Gnmt UTSW 17 46725966 missense probably damaging 1.00
R4669:Gnmt UTSW 17 46726299 nonsense probably null
R4827:Gnmt UTSW 17 46727319 missense possibly damaging 0.77
R5112:Gnmt UTSW 17 46726330 missense probably damaging 1.00
R5133:Gnmt UTSW 17 46725934 missense probably benign
R5797:Gnmt UTSW 17 46726379 missense probably damaging 1.00
R7423:Gnmt UTSW 17 46726140 missense probably damaging 1.00
R7825:Gnmt UTSW 17 46729093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGTTTCGGCAGATGCTCTC -3'
(R):5'- TGCCAGAGGATTATAAGTGCGG -3'

Sequencing Primer
(F):5'- TACTACCCTGATGAGCAAGGGC -3'
(R):5'- GATCGCGTGGCCTGAGAG -3'
Posted On2015-02-19