Incidental Mutation 'R3620:Olfr1261'
ID268582
Institutional Source Beutler Lab
Gene Symbol Olfr1261
Ensembl Gene ENSMUSG00000061295
Gene Nameolfactory receptor 1261
SynonymsGA_x6K02T2Q125-51425355-51426275, MOR234-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89991221-89996189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89993852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 153 (I153T)
Ref Sequence ENSEMBL: ENSMUSP00000150711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077785] [ENSMUST00000111509] [ENSMUST00000213909] [ENSMUST00000216953]
Predicted Effect probably damaging
Transcript: ENSMUST00000077785
AA Change: I153T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076959
Gene: ENSMUSG00000061295
AA Change: I153T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-26 PFAM
Pfam:7tm_4 134 275 4.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111509
SMART Domains Protein: ENSMUSP00000107134
Gene: ENSMUSG00000061295

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.8e-41 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213909
AA Change: I153T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216953
AA Change: I153T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Olfr1261
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Olfr1261 APN 2 89994312 missense probably benign 0.00
R0140:Olfr1261 UTSW 2 89994119 missense probably damaging 1.00
R0220:Olfr1261 UTSW 2 89993862 missense probably benign 0.08
R0243:Olfr1261 UTSW 2 89993806 missense probably benign 0.01
R1644:Olfr1261 UTSW 2 89993953 missense possibly damaging 0.60
R1669:Olfr1261 UTSW 2 89993800 unclassified probably null
R1916:Olfr1261 UTSW 2 89993804 missense probably benign
R4190:Olfr1261 UTSW 2 89993574 nonsense probably null
R5260:Olfr1261 UTSW 2 89994182 missense probably damaging 1.00
R5591:Olfr1261 UTSW 2 89993407 missense possibly damaging 0.95
R5907:Olfr1261 UTSW 2 89993957 missense probably benign 0.01
R5910:Olfr1261 UTSW 2 89993438 missense probably benign 0.29
R6044:Olfr1261 UTSW 2 89993417 missense possibly damaging 0.89
R6556:Olfr1261 UTSW 2 89994173 missense probably benign 0.39
R7083:Olfr1261 UTSW 2 89993857 missense probably benign
R7439:Olfr1261 UTSW 2 89993839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAATGGCTGCATGACTCAG -3'
(R):5'- TTCTCAGGGAGCGAAGGATG -3'

Sequencing Primer
(F):5'- CATGACTCAGCTTTTTGTGGAGC -3'
(R):5'- GGATGACCACATAGGAAGCAACC -3'
Posted On2015-02-19