Incidental Mutation 'R3620:Olfr1282'
ID268583
Institutional Source Beutler Lab
Gene Symbol Olfr1282
Ensembl Gene ENSMUSG00000096554
Gene Nameolfactory receptor 1282
SynonymsMOR248-2, Olfr1557, GA_x6K02T2Q125-72387537-72386620, MOR248-16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111335159-111336076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111335344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 245 (I245L)
Ref Sequence ENSEMBL: ENSMUSP00000097213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099618] [ENSMUST00000208176]
Predicted Effect probably benign
Transcript: ENSMUST00000099618
AA Change: I245L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097213
Gene: ENSMUSG00000096554
AA Change: I245L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.5e-47 PFAM
Pfam:7tm_1 41 287 2.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Olfr1282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Olfr1282 APN 2 111335802 missense probably damaging 1.00
R0798:Olfr1282 UTSW 2 111335344 missense probably benign 0.16
R0932:Olfr1282 UTSW 2 111335198 missense probably benign 0.00
R0972:Olfr1282 UTSW 2 111335418 missense probably benign 0.18
R1033:Olfr1282 UTSW 2 111335802 missense probably damaging 1.00
R1864:Olfr1282 UTSW 2 111335707 missense possibly damaging 0.95
R1879:Olfr1282 UTSW 2 111335463 missense possibly damaging 0.61
R2343:Olfr1282 UTSW 2 111335700 missense probably damaging 1.00
R2509:Olfr1282 UTSW 2 111335731 missense probably damaging 0.98
R5589:Olfr1282 UTSW 2 111335505 missense possibly damaging 0.46
R6487:Olfr1282 UTSW 2 111335667 missense probably benign 0.00
R6818:Olfr1282 UTSW 2 111335314 missense probably benign 0.22
R7153:Olfr1282 UTSW 2 111335901 missense probably damaging 1.00
R7480:Olfr1282 UTSW 2 111335392 missense probably benign 0.22
R7589:Olfr1282 UTSW 2 111335374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTACCTACCAATAGCTTTGAG -3'
(R):5'- TAGCCTGCATGAATACTGATACTCTG -3'

Sequencing Primer
(F):5'- TCAGAATTCACTTGTGACTTATGAG -3'
(R):5'- GGAAATCCTAATAAATGCTGACAGTG -3'
Posted On2015-02-19