Incidental Mutation 'R3620:Hdc'
ID 268586
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, L-histidine decarboxylase, Hdc-e, Hdc-c
Accession Numbers
Essential gene? Probably essential (E-score: 0.834) question?
Stock # R3620 (G1)
Quality Score 188
Status Validated
Chromosome 2
Chromosomal Location 126435587-126461219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126458187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 45 (Y45F)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect possibly damaging
Transcript: ENSMUST00000028838
AA Change: Y45F

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: Y45F

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148591
Meta Mutation Damage Score 0.3248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,226,864 (GRCm39) M473T probably benign Het
Asxl1 C A 2: 153,199,075 (GRCm39) R76S probably damaging Het
Bhlhe41 C A 6: 145,808,733 (GRCm39) G360C possibly damaging Het
Ccdc88a T C 11: 29,380,227 (GRCm39) I201T probably benign Het
Ccng1 T C 11: 40,642,992 (GRCm39) T152A probably benign Het
Cep192 T C 18: 67,962,928 (GRCm39) V648A probably benign Het
Cldn16 T A 16: 26,296,302 (GRCm39) F93I possibly damaging Het
Csmd1 T C 8: 16,042,684 (GRCm39) S2350G probably benign Het
Enpp6 T C 8: 47,518,540 (GRCm39) W223R probably benign Het
Fah T C 7: 84,238,159 (GRCm39) probably null Het
Fat2 A T 11: 55,147,521 (GRCm39) V3907D probably damaging Het
Fsip2 C A 2: 82,810,602 (GRCm39) T2307K probably benign Het
Gcg T C 2: 62,307,279 (GRCm39) E94G probably damaging Het
Gramd1b C A 9: 40,366,842 (GRCm39) R42L probably benign Het
H2bc9 C A 13: 23,727,324 (GRCm39) V67L probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Igsf10 T G 3: 59,243,752 (GRCm39) D194A probably damaging Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Lrpprc A T 17: 85,077,452 (GRCm39) C412S probably benign Het
Mga T A 2: 119,747,149 (GRCm39) D433E probably damaging Het
Myo15a A T 11: 60,369,468 (GRCm39) S743C possibly damaging Het
Myo15b T G 11: 115,762,013 (GRCm39) L1176R possibly damaging Het
Ndor1 T C 2: 25,138,047 (GRCm39) Q526R probably damaging Het
Nipbl A G 15: 8,362,508 (GRCm39) I1429T probably damaging Het
Or1d2 T A 11: 74,256,050 (GRCm39) L185Q probably damaging Het
Or4c126 T C 2: 89,824,196 (GRCm39) I153T probably damaging Het
Or4k38 T A 2: 111,165,689 (GRCm39) I245L probably benign Het
Otogl T C 10: 107,710,232 (GRCm39) D619G probably damaging Het
Pa2g4 C G 10: 128,399,464 (GRCm39) E67Q probably damaging Het
Pnpla1 C T 17: 29,096,362 (GRCm39) A147V probably damaging Het
Prdm13 A G 4: 21,683,532 (GRCm39) Y143H unknown Het
Rad23a A G 8: 85,567,193 (GRCm39) M1T probably null Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Slc10a2 A T 8: 5,154,909 (GRCm39) I92N probably damaging Het
Slc24a4 T C 12: 102,185,222 (GRCm39) F111L probably damaging Het
Sox11 T C 12: 27,391,735 (GRCm39) T225A probably benign Het
Thbs1 T C 2: 117,951,640 (GRCm39) V820A probably benign Het
Unc45a G T 7: 79,983,799 (GRCm39) N332K possibly damaging Het
Vmn1r159 A C 7: 22,542,258 (GRCm39) I258S possibly damaging Het
Wdr31 A T 4: 62,375,701 (GRCm39) F251L possibly damaging Het
Wdr43 C T 17: 71,957,601 (GRCm39) T530M probably benign Het
Zfp445 C T 9: 122,681,833 (GRCm39) A703T probably benign Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126,443,792 (GRCm39) missense probably benign 0.00
IGL01024:Hdc APN 2 126,445,766 (GRCm39) missense probably benign 0.32
IGL01393:Hdc APN 2 126,436,581 (GRCm39) missense probably benign 0.28
IGL01802:Hdc APN 2 126,445,814 (GRCm39) missense probably benign 0.04
IGL01958:Hdc APN 2 126,436,452 (GRCm39) missense possibly damaging 0.87
IGL02193:Hdc APN 2 126,443,700 (GRCm39) splice site probably benign
IGL02494:Hdc APN 2 126,436,041 (GRCm39) missense probably benign
IGL02696:Hdc APN 2 126,436,220 (GRCm39) missense probably damaging 1.00
IGL02874:Hdc APN 2 126,443,596 (GRCm39) missense probably benign 0.21
R0453:Hdc UTSW 2 126,436,871 (GRCm39) splice site probably benign
R0528:Hdc UTSW 2 126,458,152 (GRCm39) missense probably benign 0.00
R1337:Hdc UTSW 2 126,458,196 (GRCm39) missense probably benign
R1862:Hdc UTSW 2 126,439,853 (GRCm39) missense probably benign 0.36
R1938:Hdc UTSW 2 126,448,317 (GRCm39) missense possibly damaging 0.86
R1994:Hdc UTSW 2 126,458,107 (GRCm39) missense probably damaging 1.00
R2230:Hdc UTSW 2 126,435,938 (GRCm39) missense possibly damaging 0.65
R2257:Hdc UTSW 2 126,458,000 (GRCm39) splice site probably null
R2921:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R2923:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R3621:Hdc UTSW 2 126,458,187 (GRCm39) missense possibly damaging 0.86
R3914:Hdc UTSW 2 126,444,926 (GRCm39) missense probably damaging 1.00
R4076:Hdc UTSW 2 126,458,181 (GRCm39) missense possibly damaging 0.92
R4114:Hdc UTSW 2 126,443,738 (GRCm39) missense probably benign 0.16
R4213:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R4827:Hdc UTSW 2 126,436,233 (GRCm39) missense probably benign
R4889:Hdc UTSW 2 126,436,053 (GRCm39) missense probably benign 0.00
R5013:Hdc UTSW 2 126,446,220 (GRCm39) missense probably benign 0.33
R5593:Hdc UTSW 2 126,460,504 (GRCm39) utr 5 prime probably benign
R5604:Hdc UTSW 2 126,436,583 (GRCm39) missense probably benign
R5637:Hdc UTSW 2 126,458,109 (GRCm39) missense probably benign 0.02
R6211:Hdc UTSW 2 126,435,897 (GRCm39) missense probably damaging 0.98
R6312:Hdc UTSW 2 126,449,326 (GRCm39) missense possibly damaging 0.65
R7730:Hdc UTSW 2 126,436,002 (GRCm39) missense possibly damaging 0.51
R7889:Hdc UTSW 2 126,458,130 (GRCm39) missense probably damaging 1.00
R8328:Hdc UTSW 2 126,443,803 (GRCm39) missense probably damaging 1.00
R8482:Hdc UTSW 2 126,436,125 (GRCm39) missense probably benign
R8517:Hdc UTSW 2 126,439,890 (GRCm39) critical splice acceptor site probably null
R9136:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R9139:Hdc UTSW 2 126,439,837 (GRCm39) missense probably damaging 1.00
R9208:Hdc UTSW 2 126,436,600 (GRCm39) missense probably benign 0.32
R9515:Hdc UTSW 2 126,458,149 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCACACTGAGTCAAGCAAG -3'
(R):5'- CCTTACTCTCAAGGACGCAC -3'

Sequencing Primer
(F):5'- CACTGAGTCAAGCAAGGGTTTCTTAG -3'
(R):5'- AGTTCTACCCCTGCCCATAAATCTAG -3'
Posted On 2015-02-19