Incidental Mutation 'R3620:Prdm13'
ID268589
Institutional Source Beutler Lab
Gene Symbol Prdm13
Ensembl Gene ENSMUSG00000040478
Gene NamePR domain containing 13
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3620 (G1)
Quality Score137
Status Validated
Chromosome4
Chromosomal Location21677480-21685963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21683532 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 143 (Y143H)
Ref Sequence ENSEMBL: ENSMUSP00000092761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076206] [ENSMUST00000095141]
Predicted Effect unknown
Transcript: ENSMUST00000076206
AA Change: Y95H
SMART Domains Protein: ENSMUSP00000075562
Gene: ENSMUSG00000040478
AA Change: Y95H

DomainStartEndE-ValueType
Blast:SET 2 118 4e-72 BLAST
PDB:3EP0|B 56 132 1e-8 PDB
ZnF_C2H2 137 159 3.34e-2 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 231 252 N/A INTRINSIC
low complexity region 267 275 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 353 370 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 546 571 N/A INTRINSIC
ZnF_C2H2 572 594 4.4e-2 SMART
ZnF_C2H2 600 622 1.92e-2 SMART
ZnF_C2H2 629 652 2.79e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000095141
AA Change: Y143H
SMART Domains Protein: ENSMUSP00000092761
Gene: ENSMUSG00000040478
AA Change: Y143H

DomainStartEndE-ValueType
Blast:SET 42 166 1e-73 BLAST
PDB:3EP0|B 104 180 1e-8 PDB
ZnF_C2H2 185 207 3.34e-2 SMART
low complexity region 252 268 N/A INTRINSIC
low complexity region 279 300 N/A INTRINSIC
low complexity region 315 323 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
low complexity region 594 619 N/A INTRINSIC
ZnF_C2H2 620 642 4.4e-2 SMART
ZnF_C2H2 648 670 1.92e-2 SMART
ZnF_C2H2 677 700 2.79e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149516
Meta Mutation Damage Score 0.1611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in the number of GABAergic and glycinergic amacrine cells, a thin retinal inner nuclear layer, altered retinal inner plexiform layer morphology, and abnormally increased spatial, temporal, and contrast sensitivities in optokinetic reponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Prdm13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02940:Prdm13 APN 4 21683421 nonsense probably null
IGL03211:Prdm13 APN 4 21678492 missense probably damaging 1.00
R0363:Prdm13 UTSW 4 21679737 missense unknown
R0512:Prdm13 UTSW 4 21678490 missense probably damaging 1.00
R0726:Prdm13 UTSW 4 21683914 missense unknown
R1056:Prdm13 UTSW 4 21678544 missense probably damaging 1.00
R1433:Prdm13 UTSW 4 21678909 missense probably damaging 1.00
R2005:Prdm13 UTSW 4 21685695 utr 5 prime probably benign
R2292:Prdm13 UTSW 4 21683914 missense unknown
R2382:Prdm13 UTSW 4 21678277 missense possibly damaging 0.73
R4039:Prdm13 UTSW 4 21685774 utr 5 prime probably benign
R4417:Prdm13 UTSW 4 21678756 missense probably benign 0.39
R4453:Prdm13 UTSW 4 21679464 missense unknown
R4850:Prdm13 UTSW 4 21678243 missense possibly damaging 0.92
R4864:Prdm13 UTSW 4 21685543 missense unknown
R4934:Prdm13 UTSW 4 21678223 utr 3 prime probably benign
R5138:Prdm13 UTSW 4 21679507 missense unknown
R5304:Prdm13 UTSW 4 21678984 missense probably damaging 1.00
R5394:Prdm13 UTSW 4 21679455 missense unknown
R5909:Prdm13 UTSW 4 21683894 missense unknown
R5964:Prdm13 UTSW 4 21683852 nonsense probably null
R6261:Prdm13 UTSW 4 21678366 missense probably damaging 1.00
R7166:Prdm13 UTSW 4 21683528 missense unknown
R7175:Prdm13 UTSW 4 21679473 missense unknown
R7549:Prdm13 UTSW 4 21679072 missense probably damaging 1.00
Z1176:Prdm13 UTSW 4 21679518 missense unknown
Z1177:Prdm13 UTSW 4 21679623 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAACTGGACTCTACTCTTGCTC -3'
(R):5'- GGCAGCCAAGCATTTCATGAG -3'

Sequencing Primer
(F):5'- TCACCCTCGCTGTTGGG -3'
(R):5'- TGAAAGGCAAGAATTCTCTCCTC -3'
Posted On2015-02-19