Incidental Mutation 'R3620:Wdr31'
ID268590
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene NameWD repeat domain 31
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3620 (G1)
Quality Score215
Status Validated
Chromosome4
Chromosomal Location62448653-62470896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62457464 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 251 (F251L)
Ref Sequence ENSEMBL: ENSMUSP00000103076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000132263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030087
AA Change: F252L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391
AA Change: F252L

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107452
AA Change: F251L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391
AA Change: F251L

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120095
AA Change: F252L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391
AA Change: F252L

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
AA Change: F91L

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391
AA Change: F91L

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153615
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62457520 missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62455837 missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62458846 missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62453912 missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62464033 missense possibly damaging 0.81
R0257:Wdr31 UTSW 4 62460518 critical splice donor site probably null
R0486:Wdr31 UTSW 4 62453893 missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62460603 missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62455943 missense probably benign 0.00
R4256:Wdr31 UTSW 4 62457438 critical splice donor site probably null
R4303:Wdr31 UTSW 4 62460389 missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62453922 missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62463400 missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62455876 missense probably benign 0.02
R6170:Wdr31 UTSW 4 62463424 missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62457565 missense probably benign 0.03
R7126:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7469:Wdr31 UTSW 4 62457531 missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7727:Wdr31 UTSW 4 62460636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAAAGGAAGCCACTGGAG -3'
(R):5'- CTGACTGGCAGCAAAGAGTCAG -3'

Sequencing Primer
(F):5'- AAGCCACTGGAGTGCAC -3'
(R):5'- GCAAAGAGTCAGGCTTTTCC -3'
Posted On2015-02-19