Incidental Mutation 'R3620:Bhlhe41'
ID268591
Institutional Source Beutler Lab
Gene Symbol Bhlhe41
Ensembl Gene ENSMUSG00000030256
Gene Namebasic helix-loop-helix family, member e41
Synonyms6430520M22Rik, Bhlhb3, DEC2, Sharp1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R3620 (G1)
Quality Score162
Status Validated
Chromosome6
Chromosomal Location145858243-145865558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 145863007 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 360 (G360C)
Ref Sequence ENSEMBL: ENSMUSP00000032386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032386] [ENSMUST00000111703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032386
AA Change: G360C

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032386
Gene: ENSMUSG00000030256
AA Change: G360C

DomainStartEndE-ValueType
HLH 50 105 4.4e-11 SMART
ORANGE 129 175 3.26e-15 SMART
low complexity region 179 204 N/A INTRINSIC
low complexity region 258 294 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111703
SMART Domains Protein: ENSMUSP00000107332
Gene: ENSMUSG00000030256

DomainStartEndE-ValueType
HLH 50 105 4.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203949
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. Defects in this gene are associated with the short sleep phenotype. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit delayed circadian phase. Mice homozygous for another knock-out allele exhibit impaired TH2 differentiation in response to numerous stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Bhlhe41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Bhlhe41 APN 6 145863037 missense possibly damaging 0.93
IGL02303:Bhlhe41 APN 6 145864156 missense probably damaging 1.00
IGL02885:Bhlhe41 APN 6 145865263 missense probably damaging 1.00
IGL03354:Bhlhe41 APN 6 145864203 missense probably damaging 1.00
R1124:Bhlhe41 UTSW 6 145863730 missense probably damaging 1.00
R4035:Bhlhe41 UTSW 6 145863028 missense probably benign 0.10
R5296:Bhlhe41 UTSW 6 145862968 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGACGTTTGAACTTGGAA -3'
(R):5'- CGCCTACGTACAGCCCTG -3'

Sequencing Primer
(F):5'- TTTGAACTTGGAAACCCGGC -3'
(R):5'- CCTGGCTAGACAAGAGCG -3'
Posted On2015-02-19