Incidental Mutation 'R3620:Vmn1r159'
ID268592
Institutional Source Beutler Lab
Gene Symbol Vmn1r159
Ensembl Gene ENSMUSG00000095931
Gene Namevomeronasal 1 receptor 159
SynonymsGm16507
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3620 (G1)
Quality Score81
Status Not validated
Chromosome7
Chromosomal Location22842688-22843605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22842833 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 258 (I258S)
Ref Sequence ENSEMBL: ENSMUSP00000129692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167871
AA Change: I258S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129692
Gene: ENSMUSG00000095931
AA Change: I258S

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 1.8e-16 PFAM
Pfam:7tm_1 31 288 7e-8 PFAM
Pfam:V1R 41 296 6.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Vmn1r159
AlleleSourceChrCoordTypePredicted EffectPPH Score
ANU23:Vmn1r159 UTSW 7 22843163 missense probably damaging 0.99
R1183:Vmn1r159 UTSW 7 22843594 missense probably null 0.80
R1522:Vmn1r159 UTSW 7 22843268 missense probably damaging 0.98
R1700:Vmn1r159 UTSW 7 22842965 missense probably damaging 1.00
R2570:Vmn1r159 UTSW 7 22842882 missense probably benign 0.07
R4939:Vmn1r159 UTSW 7 22842891 missense probably damaging 1.00
R4985:Vmn1r159 UTSW 7 22843534 missense probably damaging 1.00
R6161:Vmn1r159 UTSW 7 22843187 missense possibly damaging 0.63
R6365:Vmn1r159 UTSW 7 22843401 missense probably damaging 1.00
R7033:Vmn1r159 UTSW 7 22842864 missense probably damaging 1.00
R7633:Vmn1r159 UTSW 7 22843023 missense probably damaging 1.00
R7817:Vmn1r159 UTSW 7 22843062 missense possibly damaging 0.47
R7846:Vmn1r159 UTSW 7 22843271 missense probably benign 0.01
R7929:Vmn1r159 UTSW 7 22843271 missense probably benign 0.01
R8008:Vmn1r159 UTSW 7 22843240 missense possibly damaging 0.56
R8019:Vmn1r159 UTSW 7 22842823 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGAAACTGTCTTCTGGATTTGGC -3'
(R):5'- TTGCAGTTTGCCTATGATGCC -3'

Sequencing Primer
(F):5'- CAGTTGAAGAGCACAGAAC -3'
(R):5'- GCCTATGATGCCACATTCATGAG -3'
Posted On2015-02-19