Incidental Mutation 'R3620:Unc45a'
ID268594
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80334051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 332 (N332K)
Ref Sequence ENSEMBL: ENSMUSP00000119665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000133728] [ENSMUST00000154428]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032748
AA Change: N332K

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: N332K

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107368
AA Change: N332K

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: N332K

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133728
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect possibly damaging
Transcript: ENSMUST00000154428
AA Change: N332K

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: N332K

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Meta Mutation Damage Score 0.0973 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 intron probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATACACTCATCTGGAAGGCC -3'
(R):5'- AATATACCTCTCTCCGTTGTGTGG -3'

Sequencing Primer
(F):5'- TCATCTGGAAGGCCTCACAG -3'
(R):5'- CATTAGGTCGTGGCCATTGATCAC -3'
Posted On2015-02-19