Incidental Mutation 'R3620:Enpp6'
ID268598
Institutional Source Beutler Lab
Gene Symbol Enpp6
Ensembl Gene ENSMUSG00000038173
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms4833421B01Rik, D8Ertd514e, Npp6, B830047L21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46986887-47096762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47065505 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 223 (W223R)
Ref Sequence ENSEMBL: ENSMUSP00000147811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039840] [ENSMUST00000119686] [ENSMUST00000123066]
Predicted Effect probably benign
Transcript: ENSMUST00000039840
AA Change: W223R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044608
Gene: ENSMUSG00000038173
AA Change: W223R

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119686
AA Change: W223R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112633
Gene: ENSMUSG00000038173
AA Change: W223R

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123066
AA Change: W223R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000149593
SMART Domains Protein: ENSMUSP00000121470
Gene: ENSMUSG00000038173

DomainStartEndE-ValueType
PDB:4LR2|A 2 74 2e-10 PDB
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleotide pyrophosphatase/phosphodiesterase family of enzymes that play an important role in regulating extracellular nucleotide metabolism. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol (GPI)-anchored membrane protein that hydrolyzes choline-containing lysophospholipids such as glycerophosphocholine. Mice lacking the encoded protein develop fatty liver and myelin sheath abnormalities. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Enpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Enpp6 APN 8 47065932 missense probably damaging 1.00
IGL02882:Enpp6 APN 8 47030532 missense probably damaging 1.00
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0331:Enpp6 UTSW 8 47082449 missense probably damaging 1.00
R0525:Enpp6 UTSW 8 47082443 missense possibly damaging 0.68
R1168:Enpp6 UTSW 8 47030454 missense probably damaging 0.96
R1295:Enpp6 UTSW 8 47065500 missense probably benign 0.00
R1533:Enpp6 UTSW 8 47065434 missense probably benign 0.02
R1923:Enpp6 UTSW 8 47082506 missense probably damaging 0.98
R2031:Enpp6 UTSW 8 47053614 missense probably damaging 0.99
R2090:Enpp6 UTSW 8 47065370 critical splice acceptor site probably null
R2656:Enpp6 UTSW 8 47082418 nonsense probably null
R3621:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3862:Enpp6 UTSW 8 47065992 missense probably benign 0.33
R4284:Enpp6 UTSW 8 47069015 missense probably damaging 1.00
R4592:Enpp6 UTSW 8 47093032 missense probably damaging 0.99
R4899:Enpp6 UTSW 8 46987083 missense probably damaging 1.00
R4963:Enpp6 UTSW 8 47065461 missense probably benign 0.30
R5201:Enpp6 UTSW 8 47065451 missense probably damaging 0.99
R5322:Enpp6 UTSW 8 47068915 missense probably benign 0.06
R5933:Enpp6 UTSW 8 47066004 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTCTCACACCTTCACAGAGG -3'
(R):5'- AACCAAGGAGTCAGTTGGTG -3'

Sequencing Primer
(F):5'- AAGCAAGTTGTCAGAGGTCTCCC -3'
(R):5'- GCCTATGTGAAAAGTGCTCG -3'
Posted On2015-02-19