Incidental Mutation 'R3620:Ccng1'
ID268606
Institutional Source Beutler Lab
Gene Symbol Ccng1
Ensembl Gene ENSMUSG00000020326
Gene Namecyclin G1
Synonymscyclin G
Accession Numbers

Genbank: NM_009831

Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location40748552-40755311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40752165 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000020576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020576]
Predicted Effect probably benign
Transcript: ENSMUST00000020576
AA Change: T152A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: T152A

DomainStartEndE-ValueType
CYCLIN 56 142 3.63e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151359
Meta Mutation Damage Score 0.7176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Ccng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ccng1 APN 11 40754058 missense probably benign 0.00
IGL01875:Ccng1 APN 11 40752356 missense probably benign 0.09
IGL02986:Ccng1 APN 11 40750863 utr 3 prime probably benign
G5030:Ccng1 UTSW 11 40753802 splice site probably benign
R1375:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1377:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1715:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R3857:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R3858:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R5082:Ccng1 UTSW 11 40752188 missense possibly damaging 0.77
R5172:Ccng1 UTSW 11 40751286 missense probably benign
R5521:Ccng1 UTSW 11 40752266 missense possibly damaging 0.87
R7431:Ccng1 UTSW 11 40753918 missense possibly damaging 0.74
R8009:Ccng1 UTSW 11 40751269 missense probably benign 0.00
T0975:Ccng1 UTSW 11 40754044 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGCAGGCATCTTTTCAC -3'
(R):5'- GCACTGTAAAGACACTGGTGTG -3'

Sequencing Primer
(F):5'- CACTTCTGTTAGGCAGCAAAG -3'
(R):5'- TGTTTGTAGGTACAGGCGAAG -3'
Posted On2015-02-19