Incidental Mutation 'R3620:Slc24a4'
ID268613
Institutional Source Beutler Lab
Gene Symbol Slc24a4
Ensembl Gene ENSMUSG00000041771
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 4
SynonymsNCKX4, A930002M03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102128733-102267091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102218963 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 111 (F111L)
Ref Sequence ENSEMBL: ENSMUSP00000124513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079020] [ENSMUST00000159329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079020
AA Change: F94L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078030
Gene: ENSMUSG00000041771
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Na_Ca_ex 86 229 2.4e-31 PFAM
low complexity region 367 388 N/A INTRINSIC
Pfam:Na_Ca_ex 435 587 2.4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159329
AA Change: F111L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124513
Gene: ENSMUSG00000041771
AA Change: F111L

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 113 245 1e-32 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 443 562 1.4e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161325
AA Change: F110L
SMART Domains Protein: ENSMUSP00000125012
Gene: ENSMUSG00000041771
AA Change: F110L

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 1.3e-31 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 433 585 1.3e-30 PFAM
Meta Mutation Damage Score 0.4847 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and reduced weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Slc24a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Slc24a4 APN 12 102223635 missense probably benign 0.09
IGL01724:Slc24a4 APN 12 102218960 missense possibly damaging 0.78
IGL01767:Slc24a4 APN 12 102223687 splice site probably benign
IGL01814:Slc24a4 APN 12 102254618 missense probably benign 0.00
IGL02047:Slc24a4 APN 12 102254623 missense probably damaging 1.00
IGL02449:Slc24a4 APN 12 102227082 missense probably benign 0.00
IGL02632:Slc24a4 APN 12 102234682 missense probably benign 0.15
IGL03251:Slc24a4 APN 12 102222825 missense probably damaging 0.98
spindly UTSW 12 102264944 critical splice donor site probably null
R0207:Slc24a4 UTSW 12 102228951 critical splice donor site probably null
R0284:Slc24a4 UTSW 12 102260481 missense probably damaging 1.00
R0506:Slc24a4 UTSW 12 102131623 critical splice donor site probably null
R1903:Slc24a4 UTSW 12 102131617 missense probably benign 0.00
R2004:Slc24a4 UTSW 12 102213907 missense probably damaging 1.00
R2126:Slc24a4 UTSW 12 102222759 missense probably damaging 1.00
R2518:Slc24a4 UTSW 12 102222051 missense probably benign 0.02
R3498:Slc24a4 UTSW 12 102234692 missense probably benign
R3621:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R4917:Slc24a4 UTSW 12 102264944 critical splice donor site probably null
R5028:Slc24a4 UTSW 12 102264370 missense probably damaging 1.00
R5886:Slc24a4 UTSW 12 102260415 missense probably damaging 1.00
R5914:Slc24a4 UTSW 12 102234790 missense probably damaging 1.00
R6257:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6305:Slc24a4 UTSW 12 102222101 missense possibly damaging 0.84
R6313:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6734:Slc24a4 UTSW 12 102219000 missense probably damaging 1.00
R7378:Slc24a4 UTSW 12 102239176 missense probably benign 0.06
R7419:Slc24a4 UTSW 12 102227091 critical splice donor site probably null
R7529:Slc24a4 UTSW 12 102264448 missense probably benign 0.01
R7715:Slc24a4 UTSW 12 102218960 missense possibly damaging 0.89
R7781:Slc24a4 UTSW 12 102234853 critical splice donor site probably null
Z1176:Slc24a4 UTSW 12 102228898 missense probably damaging 1.00
Z1176:Slc24a4 UTSW 12 102239238 missense probably benign 0.01
Z1177:Slc24a4 UTSW 12 102260420 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTATTTCATACTCTGCGACAGTG -3'
(R):5'- AGAGTGCTTCCTGTCCCATC -3'

Sequencing Primer
(F):5'- TCTGCGACAGTGCTGAGAG -3'
(R):5'- GTGCTTCCTGTCCCATCTGACC -3'
Posted On2015-02-19