Incidental Mutation 'R3620:Hist1h2bh'
ID268614
Institutional Source Beutler Lab
Gene Symbol Hist1h2bh
Ensembl Gene ENSMUSG00000114456
Gene Namehistone cluster 1, H2bh
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R3620 (G1)
Quality Score124
Status Validated
Chromosome13
Chromosomal Location23541714-23543392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23543154 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 67 (V67L)
Ref Sequence ENSEMBL: ENSMUSP00000153277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075558] [ENSMUST00000078156] [ENSMUST00000224359]
Predicted Effect probably benign
Transcript: ENSMUST00000075558
SMART Domains Protein: ENSMUSP00000074994
Gene: ENSMUSG00000100210

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078156
AA Change: V67L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077290
Gene: ENSMUSG00000069307
AA Change: V67L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224359
AA Change: V67L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Hist1h2bh
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2266:Hist1h2bh UTSW 13 23542992 missense possibly damaging 0.91
R2267:Hist1h2bh UTSW 13 23542992 missense possibly damaging 0.91
R2299:Hist1h2bh UTSW 13 23543184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTCTTGAGCACTCACTTGG -3'
(R):5'- TGTTCACTATGCCTGAGCCC -3'

Sequencing Primer
(F):5'- CTCACTTGGAGCTGGTGTAC -3'
(R):5'- TATGCCTGAGCCCGCCAAG -3'
Posted On2015-02-19