Incidental Mutation 'R3620:Cldn16'
ID268617
Institutional Source Beutler Lab
Gene Symbol Cldn16
Ensembl Gene ENSMUSG00000038148
Gene Nameclaudin 16
SynonymsPCLN1, claudin-16, paracellin-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26463135-26482765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26477552 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 93 (F93I)
Ref Sequence ENSEMBL: ENSMUSP00000124528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115302] [ENSMUST00000161053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115302
AA Change: F93I

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110957
Gene: ENSMUSG00000038148
AA Change: F93I

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.1e-20 PFAM
Pfam:Claudin_2 14 185 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161053
AA Change: F93I

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124528
Gene: ENSMUSG00000038148
AA Change: F93I

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 183 2.2e-20 PFAM
Pfam:Claudin_2 14 185 1.2e-12 PFAM
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display an age-dependent progressive phenotype that includes hypercalciuria and hypomagnesemia, significantly elevated serum parathyroid hormone and calcitriol (1,25(OH)2D3) levels, and a significantly lower urinary pH but no nephrocalcinosis or renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Cldn16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Cldn16 APN 16 26482546 nonsense probably null
R1469:Cldn16 UTSW 16 26474180 splice site probably benign
R4586:Cldn16 UTSW 16 26477558 missense probably benign 0.00
R6135:Cldn16 UTSW 16 26474268 missense possibly damaging 0.66
R6257:Cldn16 UTSW 16 26481330 missense probably damaging 0.96
R6818:Cldn16 UTSW 16 26477507 missense probably damaging 1.00
R7129:Cldn16 UTSW 16 26482638 missense probably damaging 1.00
Z1177:Cldn16 UTSW 16 26481250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGATGTTCCTGTGCAAG -3'
(R):5'- TACACTATCAGGAGGCAAGATATG -3'

Sequencing Primer
(F):5'- GCAAGTTAATGTGTCTGTACATCTCC -3'
(R):5'- TGATAAATTCGTGTAGCACAACTCG -3'
Posted On2015-02-19