Incidental Mutation 'R3620:Pnpla1'
ID268619
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28877388 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 147 (A147V)
Ref Sequence ENSEMBL: ENSMUSP00000050123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect probably damaging
Transcript: ENSMUST00000056866
AA Change: A147V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: A147V

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114737
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5042:Pnpla1 UTSW 17 28881047 missense probably benign
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R5886:Pnpla1 UTSW 17 28876863 missense possibly damaging 0.63
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7400:Pnpla1 UTSW 17 28858976 missense probably damaging 1.00
R7444:Pnpla1 UTSW 17 28878481 missense possibly damaging 0.95
R7507:Pnpla1 UTSW 17 28876817 missense probably damaging 1.00
R7513:Pnpla1 UTSW 17 28858807 start gained probably benign
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCGGTAGATTACTAAGGCCC -3'
(R):5'- ACGCTGACTTCTGGGAGAAC -3'

Sequencing Primer
(F):5'- GTAGATTACTAAGGCCCCAACTAGG -3'
(R):5'- GGCAACCTTGGGACTTTGAC -3'
Posted On2015-02-19