Incidental Mutation 'R3620:Wdr43'
ID268620
Institutional Source Beutler Lab
Gene Symbol Wdr43
Ensembl Gene ENSMUSG00000041057
Gene NameWD repeat domain 43
Synonyms2610318G08Rik
Accession Numbers

Ncbi RefSeq: NM_175639.1; MGI:1919765

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71616215-71659031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71650606 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 530 (T530M)
Ref Sequence ENSEMBL: ENSMUSP00000048337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047086]
Predicted Effect probably benign
Transcript: ENSMUST00000047086
AA Change: T530M

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048337
Gene: ENSMUSG00000041057
AA Change: T530M

DomainStartEndE-ValueType
WD40 8 42 4.42e1 SMART
WD40 45 110 2.2e2 SMART
WD40 113 154 7.85e-7 SMART
WD40 157 194 1.24e-4 SMART
WD40 197 249 5.52e0 SMART
Blast:WD40 256 299 1e-18 BLAST
low complexity region 320 334 N/A INTRINSIC
Pfam:Utp12 472 575 2.3e-23 PFAM
coiled coil region 635 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
Allele List at MGI

All alleles(36) : Gene trapped(36)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Wdr43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr43 APN 17 71652814 missense probably damaging 1.00
IGL02077:Wdr43 APN 17 71640291 missense probably benign 0.00
IGL02114:Wdr43 APN 17 71652848 missense probably benign 0.00
IGL02252:Wdr43 APN 17 71626850 missense probably damaging 1.00
IGL02352:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL02359:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL03082:Wdr43 APN 17 71638341 missense probably damaging 0.99
IGL03095:Wdr43 APN 17 71641287 missense probably benign 0.28
IGL02837:Wdr43 UTSW 17 71642736 missense probably benign 0.00
R0039:Wdr43 UTSW 17 71653492 nonsense probably null
R0164:Wdr43 UTSW 17 71631997 splice site probably benign
R0271:Wdr43 UTSW 17 71626825 missense probably benign 0.00
R1117:Wdr43 UTSW 17 71616387 missense probably benign 0.35
R1873:Wdr43 UTSW 17 71633652 missense probably benign 0.05
R1973:Wdr43 UTSW 17 71640240 missense probably benign 0.00
R3922:Wdr43 UTSW 17 71638301 splice site probably benign
R4097:Wdr43 UTSW 17 71657537 missense probably benign
R5067:Wdr43 UTSW 17 71626854 missense probably benign
R5282:Wdr43 UTSW 17 71648777 missense probably damaging 1.00
R6251:Wdr43 UTSW 17 71650053 splice site probably null
R6364:Wdr43 UTSW 17 71657654 missense probably damaging 0.96
R7086:Wdr43 UTSW 17 71616439 missense probably benign 0.02
R7725:Wdr43 UTSW 17 71616343 missense probably benign 0.27
R8104:Wdr43 UTSW 17 71616355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGGTGGAACAAATGGCCT -3'
(R):5'- GCAAATATACCAAAGAGTCCAATCTTA -3'

Sequencing Primer
(F):5'- TGGCCTGGGACATACAGTG -3'
(R):5'- CCTCCTAAGTGCTGAGGTTAAAG -3'
Posted On2015-02-19