Incidental Mutation 'R3620:Lrpprc'
ID 268621
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3620 (G1)
Quality Score 209
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85077452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 412 (C412S)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect probably benign
Transcript: ENSMUST00000112308
AA Change: C412S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: C412S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161928
Meta Mutation Damage Score 0.2413 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,226,864 (GRCm39) M473T probably benign Het
Asxl1 C A 2: 153,199,075 (GRCm39) R76S probably damaging Het
Bhlhe41 C A 6: 145,808,733 (GRCm39) G360C possibly damaging Het
Ccdc88a T C 11: 29,380,227 (GRCm39) I201T probably benign Het
Ccng1 T C 11: 40,642,992 (GRCm39) T152A probably benign Het
Cep192 T C 18: 67,962,928 (GRCm39) V648A probably benign Het
Cldn16 T A 16: 26,296,302 (GRCm39) F93I possibly damaging Het
Csmd1 T C 8: 16,042,684 (GRCm39) S2350G probably benign Het
Enpp6 T C 8: 47,518,540 (GRCm39) W223R probably benign Het
Fah T C 7: 84,238,159 (GRCm39) probably null Het
Fat2 A T 11: 55,147,521 (GRCm39) V3907D probably damaging Het
Fsip2 C A 2: 82,810,602 (GRCm39) T2307K probably benign Het
Gcg T C 2: 62,307,279 (GRCm39) E94G probably damaging Het
Gramd1b C A 9: 40,366,842 (GRCm39) R42L probably benign Het
H2bc9 C A 13: 23,727,324 (GRCm39) V67L probably benign Het
Hdc T A 2: 126,458,187 (GRCm39) Y45F possibly damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Igsf10 T G 3: 59,243,752 (GRCm39) D194A probably damaging Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Mga T A 2: 119,747,149 (GRCm39) D433E probably damaging Het
Myo15a A T 11: 60,369,468 (GRCm39) S743C possibly damaging Het
Myo15b T G 11: 115,762,013 (GRCm39) L1176R possibly damaging Het
Ndor1 T C 2: 25,138,047 (GRCm39) Q526R probably damaging Het
Nipbl A G 15: 8,362,508 (GRCm39) I1429T probably damaging Het
Or1d2 T A 11: 74,256,050 (GRCm39) L185Q probably damaging Het
Or4c126 T C 2: 89,824,196 (GRCm39) I153T probably damaging Het
Or4k38 T A 2: 111,165,689 (GRCm39) I245L probably benign Het
Otogl T C 10: 107,710,232 (GRCm39) D619G probably damaging Het
Pa2g4 C G 10: 128,399,464 (GRCm39) E67Q probably damaging Het
Pnpla1 C T 17: 29,096,362 (GRCm39) A147V probably damaging Het
Prdm13 A G 4: 21,683,532 (GRCm39) Y143H unknown Het
Rad23a A G 8: 85,567,193 (GRCm39) M1T probably null Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Slc10a2 A T 8: 5,154,909 (GRCm39) I92N probably damaging Het
Slc24a4 T C 12: 102,185,222 (GRCm39) F111L probably damaging Het
Sox11 T C 12: 27,391,735 (GRCm39) T225A probably benign Het
Thbs1 T C 2: 117,951,640 (GRCm39) V820A probably benign Het
Unc45a G T 7: 79,983,799 (GRCm39) N332K possibly damaging Het
Vmn1r159 A C 7: 22,542,258 (GRCm39) I258S possibly damaging Het
Wdr31 A T 4: 62,375,701 (GRCm39) F251L possibly damaging Het
Wdr43 C T 17: 71,957,601 (GRCm39) T530M probably benign Het
Zfp445 C T 9: 122,681,833 (GRCm39) A703T probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTAGCTCAGAGGCACTTATTAATG -3'
(R):5'- GGATTGACTGTTGAAGAAAGTCATG -3'

Sequencing Primer
(F):5'- GTCACCAGGCTAGCTCAGAC -3'
(R):5'- ACTGTTGAAGAAAGTCATGTGGTC -3'
Posted On 2015-02-19