Incidental Mutation 'R3621:Hspa8'
ID268633
Institutional Source Beutler Lab
Gene Symbol Hspa8
Ensembl Gene ENSMUSG00000015656
Gene Nameheat shock protein 8
SynonymsHsp73, Hsc71, Hsc70, 2410008N15Rik, Hsc73
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R3621 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40800984-40810087 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 40801923 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000117285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015800] [ENSMUST00000117557] [ENSMUST00000133964]
Predicted Effect probably benign
Transcript: ENSMUST00000015800
AA Change: M1L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000015800
Gene: ENSMUSG00000015656
AA Change: M1L

DomainStartEndE-ValueType
Pfam:HSP70 6 612 2.3e-272 PFAM
Pfam:MreB_Mbl 117 383 5.3e-19 PFAM
low complexity region 613 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101927
Predicted Effect possibly damaging
Transcript: ENSMUST00000117557
AA Change: M1L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113722
Gene: ENSMUSG00000015656
AA Change: M1L

DomainStartEndE-ValueType
Pfam:HSP70 6 593 3e-255 PFAM
low complexity region 594 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117870
SMART Domains Protein: ENSMUSP00000114081
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 118 2.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127699
Predicted Effect probably damaging
Transcript: ENSMUST00000133964
AA Change: M1L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117285
Gene: ENSMUSG00000015656
AA Change: M1L

DomainStartEndE-ValueType
Pfam:HSP70 6 116 2.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215526
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,152,303 S161P probably damaging Het
Atp8a2 C A 14: 60,026,138 probably null Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Erich3 T C 3: 154,748,732 Y515H possibly damaging Het
Fam118a T C 15: 85,045,801 F77L probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ilvbl G A 10: 78,577,180 V179M probably damaging Het
Mettl4 T C 17: 94,735,508 Y300C probably damaging Het
Olfr77 T C 9: 19,920,913 Y235H probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Tep1 G A 14: 50,829,020 R2328C probably damaging Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Timd2 G A 11: 46,678,213 T206I probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Zpbp2 A G 11: 98,552,556 T18A probably benign Het
Other mutations in Hspa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Hspa8 APN 9 40804928 unclassified probably benign
R0006:Hspa8 UTSW 9 40804629 missense probably benign 0.05
R0799:Hspa8 UTSW 9 40803841 missense probably damaging 1.00
R0866:Hspa8 UTSW 9 40802624 critical splice donor site probably null
R4475:Hspa8 UTSW 9 40804146 unclassified probably benign
R5096:Hspa8 UTSW 9 40802901 unclassified probably benign
R6116:Hspa8 UTSW 9 40804975 missense probably damaging 0.98
R6363:Hspa8 UTSW 9 40803065 missense probably damaging 1.00
R7067:Hspa8 UTSW 9 40804625 missense probably damaging 0.97
R7310:Hspa8 UTSW 9 40803408 missense probably benign 0.09
R7549:Hspa8 UTSW 9 40802959 splice site probably null
R7998:Hspa8 UTSW 9 40804514 missense probably damaging 1.00
Z1177:Hspa8 UTSW 9 40802802 missense probably damaging 0.98
Z1177:Hspa8 UTSW 9 40802805 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGACCTTTAGGACAGATGGTTCC -3'
(R):5'- TGGTGGGGTTCATTGCAACC -3'

Sequencing Primer
(F):5'- ACAGATGGTTCCTTGAGCC -3'
(R):5'- GGGTTCATTGCAACCTGATTC -3'
Posted On2015-02-19