Incidental Mutation 'R3622:Tgm6'
ID268655
Institutional Source Beutler Lab
Gene Symbol Tgm6
Ensembl Gene ENSMUSG00000027403
Gene Nametransglutaminase 6
SynonymsTGM3L
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130112416-130154232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130151761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 640 (V640E)
Ref Sequence ENSEMBL: ENSMUSP00000028888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028888
AA Change: V640E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: V640E

DomainStartEndE-ValueType
Pfam:Transglut_N 5 119 3e-31 PFAM
TGc 266 359 3.48e-40 SMART
low complexity region 466 483 N/A INTRINSIC
Pfam:Transglut_C 495 600 2.4e-23 PFAM
Pfam:Transglut_C 607 704 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147616
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Tgm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Tgm6 APN 2 130136495 missense probably benign 0.00
IGL01331:Tgm6 APN 2 130143618 splice site probably null
IGL01348:Tgm6 APN 2 130137379 missense probably damaging 1.00
IGL01787:Tgm6 APN 2 130151434 splice site probably benign
IGL02208:Tgm6 APN 2 130135870 missense probably benign 0.11
IGL02656:Tgm6 APN 2 130145103 missense probably damaging 1.00
IGL03280:Tgm6 APN 2 130138931 missense probably damaging 1.00
R0200:Tgm6 UTSW 2 130152945 splice site probably null
R0507:Tgm6 UTSW 2 130138831 missense possibly damaging 0.56
R0744:Tgm6 UTSW 2 130151761 missense probably benign 0.00
R0800:Tgm6 UTSW 2 130143422 missense possibly damaging 0.94
R1530:Tgm6 UTSW 2 130151282 missense possibly damaging 0.71
R1573:Tgm6 UTSW 2 130151740 missense probably benign 0.00
R1706:Tgm6 UTSW 2 130145159 missense possibly damaging 0.53
R2330:Tgm6 UTSW 2 130143242 missense probably damaging 1.00
R2881:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R2882:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R3624:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R4370:Tgm6 UTSW 2 130143605 missense probably benign 0.12
R4664:Tgm6 UTSW 2 130137394 missense probably benign 0.05
R4664:Tgm6 UTSW 2 130141208 missense probably benign 0.34
R4983:Tgm6 UTSW 2 130141193 missense probably damaging 0.99
R5182:Tgm6 UTSW 2 130141302 missense probably damaging 0.98
R5397:Tgm6 UTSW 2 130141908 missense possibly damaging 0.90
R5411:Tgm6 UTSW 2 130145196 missense probably benign 0.01
R5683:Tgm6 UTSW 2 130138955 missense probably damaging 1.00
R5933:Tgm6 UTSW 2 130141256 missense probably damaging 1.00
R6016:Tgm6 UTSW 2 130141228 missense probably damaging 0.99
R7252:Tgm6 UTSW 2 130144964 missense probably damaging 1.00
R7290:Tgm6 UTSW 2 130141190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACATTCTCTGGTCCAG -3'
(R):5'- TGGAAACAGTAGTTGTACGCATG -3'

Sequencing Primer
(F):5'- TGGTCCAGCCAGAATTCATG -3'
(R):5'- TTGTACGCATGAAGGACAGACC -3'
Posted On2015-02-19