Incidental Mutation 'R3622:Smad9'
ID268657
Institutional Source Beutler Lab
Gene Symbol Smad9
Ensembl Gene ENSMUSG00000027796
Gene NameSMAD family member 9
SynonymsSMAD8A, MADH6, SMAD8B, Madh9
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54755582-54801257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54789284 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 257 (R257W)
Ref Sequence ENSEMBL: ENSMUSP00000029371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371]
Predicted Effect probably damaging
Transcript: ENSMUST00000029371
AA Change: R257W

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796
AA Change: R257W

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that act as downstream effectors of the bone morphogenetic protein (BMP) signaling pathway. The encoded protein is phosphorylated by BMP receptors, which stimulates its binding to SMAD4 and translocation into the nucleus, where it functions as a regulator of transcription. Activity of this protein is important for embryonic development. Mutation of this gene results in defects in pulmonary vasculature. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice in which exon 3 was deleted are viable and fertile. Mutant mice in which a neo cassette is inserted in exon 3 resulting in a hypomorphic allele exhibit reduced midbrain and hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Smad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Smad9 APN 3 54786172 missense possibly damaging 0.95
IGL02666:Smad9 APN 3 54782467 missense probably damaging 1.00
IGL03346:Smad9 APN 3 54789215 missense probably benign
R1839:Smad9 UTSW 3 54789179 splice site probably benign
R1888:Smad9 UTSW 3 54789179 splice site probably benign
R3623:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3624:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3708:Smad9 UTSW 3 54786181 missense probably benign
R4469:Smad9 UTSW 3 54782761 missense probably damaging 1.00
R4756:Smad9 UTSW 3 54794453 missense possibly damaging 0.50
R4938:Smad9 UTSW 3 54789230 missense probably benign 0.00
R5139:Smad9 UTSW 3 54797406 missense possibly damaging 0.94
R5783:Smad9 UTSW 3 54794442 missense probably benign 0.15
R6200:Smad9 UTSW 3 54789186 missense probably benign
R6437:Smad9 UTSW 3 54786084 missense probably benign 0.33
R6478:Smad9 UTSW 3 54782443 missense probably damaging 1.00
R6552:Smad9 UTSW 3 54782746 missense probably damaging 1.00
R7058:Smad9 UTSW 3 54786193 missense probably benign 0.01
R7314:Smad9 UTSW 3 54789323 missense probably benign 0.00
R7492:Smad9 UTSW 3 54786326 splice site probably null
R7683:Smad9 UTSW 3 54789264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGTTGCAATCGTGAG -3'
(R):5'- AGGGCTTTCTAAAGGACCGC -3'

Sequencing Primer
(F):5'- TTGCAATCGTGAGCTCCG -3'
(R):5'- GGCTTTCTAAAGGACCGCTTATAGC -3'
Posted On2015-02-19