Mutagenetix > Incidental Mutations

Incidental Mutation 'R3622:Grid2ip'

268666

Institutional Source

Beutler Lab

Gene Symbol

Grid2ip

Ensembl Gene

ENSMUSG00000010825

Gene Name

glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1

Synonyms

delphilin

MMRRC Submission

040677-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R3622 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

143357338-143392152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143386019 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 666 (S666P)

Ref Sequence

ENSEMBL: ENSMUSP00000010969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]

Predicted Effect

probably damaging
Transcript: ENSMUST00000010969
AA Change: S666P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: S666P

Domain	Start	End	E-Value	Type
low complexity region	30	55	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	78	92	N/A	INTRINSIC
PDZ	97	166	9.5e-16	SMART
low complexity region	256	272	N/A	INTRINSIC
low complexity region	284	304	N/A	INTRINSIC
low complexity region	429	446	N/A	INTRINSIC
low complexity region	464	478	N/A	INTRINSIC
low complexity region	536	584	N/A	INTRINSIC
low complexity region	607	625	N/A	INTRINSIC
FH2	633	1022	1.39e-35	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110733
AA Change: S845P

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: S845P

Domain	Start	End	E-Value	Type
PDZ	10	80	1.13e-13	SMART
low complexity region	98	109	N/A	INTRINSIC
low complexity region	209	234	N/A	INTRINSIC
low complexity region	236	252	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
PDZ	276	345	9.5e-16	SMART
low complexity region	435	451	N/A	INTRINSIC
low complexity region	463	483	N/A	INTRINSIC
low complexity region	608	625	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	715	763	N/A	INTRINSIC
low complexity region	786	804	N/A	INTRINSIC
FH2	812	1201	1.39e-35	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120825
AA Change: S673P

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: S673P

Domain	Start	End	E-Value	Type
low complexity region	37	62	N/A	INTRINSIC
low complexity region	64	80	N/A	INTRINSIC
low complexity region	85	99	N/A	INTRINSIC
PDZ	104	173	9.5e-16	SMART
low complexity region	263	279	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	543	591	N/A	INTRINSIC
low complexity region	614	632	N/A	INTRINSIC
FH2	640	1029	1.39e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176473

Meta Mutation Damage Score

0.3494

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,350,813	Y503*	probably null	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dpf1	G	A	7: 29,316,206		probably null	Het
Gucy2e	T	A	11: 69,225,051	E835V	probably damaging	Het
Hdac5	G	A	11: 102,195,818	P120S	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Ikbkap	A	T	4: 56,759,925		probably null	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Mga	A	G	2: 119,941,764	T1702A	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Muc5b	T	C	7: 141,851,858		probably benign	Het
Olfr1461	T	A	19: 13,165,656	M214K	probably benign	Het
Olfr390	A	G	11: 73,787,741	T268A	probably benign	Het
Olfr912	A	G	9: 38,581,496	Y73C	probably damaging	Het
Olfr994	C	T	2: 85,430,493	C112Y	probably benign	Het
Oma1	T	C	4: 103,366,091	I491T	probably benign	Het
Pbld2	T	C	10: 63,061,691	L57P	probably damaging	Het
Phka2	T	A	X: 160,544,295	Y334*	probably null	Het
Plin4	G	T	17: 56,104,112	T973K	possibly damaging	Het
R3hdm4	C	T	10: 79,912,681	R143H	possibly damaging	Het
Rps18	G	C	17: 33,952,273		probably null	Het
Samd9l	A	T	6: 3,374,032	C1076*	probably null	Het
Scml4	T	C	10: 42,930,611		probably benign	Het
Slc16a10	A	G	10: 40,141,894	V48A	probably benign	Het
Slc6a5	T	C	7: 49,917,623	V275A	probably benign	Het
Smad9	C	T	3: 54,789,284	R257W	probably damaging	Het
Snrpb	C	A	2: 130,175,379	R73L	probably null	Het
Srsf9	C	T	5: 115,330,512	A69V	probably damaging	Het
Stfa2	A	G	16: 36,404,071	Y90H	probably damaging	Het
Tgm6	T	A	2: 130,151,761	V640E	possibly damaging	Het
Tnrc6c	C	T	11: 117,749,625	R1414C	probably damaging	Het
Tyk2	A	T	9: 21,127,310	C8S	probably damaging	Het
Upp2	G	A	2: 58,790,116	R300Q	possibly damaging	Het
Utp20	A	G	10: 88,757,993		probably benign	Het
Veph1	C	T	3: 66,215,437	V224I	probably benign	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r116	A	G	17: 23,386,051	S113G	probably benign	Het
Vps53	A	C	11: 76,117,783	V237G	probably benign	Het

Other mutations in Grid2ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02271:Grid2ip	APN	5	143388909	missense	probably benign
IGL02894:Grid2ip	APN	5	143391108	missense	probably benign	0.04
R0024:Grid2ip	UTSW	5	143391041	missense	probably damaging	1.00
R0355:Grid2ip	UTSW	5	143357897	missense	probably benign	0.10
R0403:Grid2ip	UTSW	5	143357620	missense	possibly damaging	0.84
R0523:Grid2ip	UTSW	5	143373043	missense	possibly damaging	0.85
R0605:Grid2ip	UTSW	5	143379362	missense	probably damaging	0.99
R0664:Grid2ip	UTSW	5	143363977	critical splice donor site	probably null
R1116:Grid2ip	UTSW	5	143382914	missense	possibly damaging	0.96
R1251:Grid2ip	UTSW	5	143386015	missense	possibly damaging	0.69
R1381:Grid2ip	UTSW	5	143362651	missense	probably benign	0.00
R1384:Grid2ip	UTSW	5	143386096	critical splice donor site	probably null
R1477:Grid2ip	UTSW	5	143375585	missense	probably damaging	1.00
R2266:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2267:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2304:Grid2ip	UTSW	5	143387840	missense	probably damaging	1.00
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2873:Grid2ip	UTSW	5	143357929	missense	probably benign
R2874:Grid2ip	UTSW	5	143357929	missense	probably benign
R3196:Grid2ip	UTSW	5	143388178	missense	probably damaging	0.99
R3930:Grid2ip	UTSW	5	143386039	missense	probably damaging	1.00
R4628:Grid2ip	UTSW	5	143382875	missense	probably damaging	1.00
R4696:Grid2ip	UTSW	5	143391376	intron	probably benign
R4709:Grid2ip	UTSW	5	143388903	missense	probably damaging	1.00
R4772:Grid2ip	UTSW	5	143375700	missense	possibly damaging	0.91
R4838:Grid2ip	UTSW	5	143388775	nonsense	probably null
R4857:Grid2ip	UTSW	5	143382629	missense	probably damaging	1.00
R5243:Grid2ip	UTSW	5	143377505	missense	probably damaging	1.00
R5894:Grid2ip	UTSW	5	143388911	missense	probably damaging	1.00
R6014:Grid2ip	UTSW	5	143387823	missense	possibly damaging	0.84
R6076:Grid2ip	UTSW	5	143387375	missense	probably benign	0.17
R6209:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6257:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6274:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6439:Grid2ip	UTSW	5	143373502	missense	probably damaging	0.99
R7098:Grid2ip	UTSW	5	143357591	missense	probably damaging	0.97
R7405:Grid2ip	UTSW	5	143380444	missense	probably benign	0.03
R7652:Grid2ip	UTSW	5	143382638	missense	probably damaging	1.00
R8259:Grid2ip	UTSW	5	143362589	missense	probably benign	0.20
R8261:Grid2ip	UTSW	5	143381940	critical splice donor site	probably null
R8350:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
R8391:Grid2ip	UTSW	5	143380196	missense	probably damaging	0.98
R8450:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
X0010:Grid2ip	UTSW	5	143357878	missense	probably benign	0.01
X0012:Grid2ip	UTSW	5	143362639	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACGGGGAGTCAGTTCTTAGC -3'
(R):5'- CATGTATGCAGAAAGGTCTTGAAG -3'

Sequencing Primer
(F):5'- CAGATACCCTGGAGCTGTAGTTAC -3'
(R):5'- AGGTCTTGAAGTTTGGAGACAC -3'

Posted On

2015-02-19