Mutagenetix > Incidental Mutation

Incidental Mutation 'R3622:Samd9l'

268667

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

040677-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 3374032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1076 (C1076*)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000120087
AA Change: C1076*

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: C1076*

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,350,813	Y503*	probably null	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dpf1	G	A	7: 29,316,206		probably null	Het
Grid2ip	T	C	5: 143,386,019	S666P	probably damaging	Het
Gucy2e	T	A	11: 69,225,051	E835V	probably damaging	Het
Hdac5	G	A	11: 102,195,818	P120S	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Ikbkap	A	T	4: 56,759,925		probably null	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Mga	A	G	2: 119,941,764	T1702A	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Muc5b	T	C	7: 141,851,858		probably benign	Het
Olfr1461	T	A	19: 13,165,656	M214K	probably benign	Het
Olfr390	A	G	11: 73,787,741	T268A	probably benign	Het
Olfr912	A	G	9: 38,581,496	Y73C	probably damaging	Het
Olfr994	C	T	2: 85,430,493	C112Y	probably benign	Het
Oma1	T	C	4: 103,366,091	I491T	probably benign	Het
Pbld2	T	C	10: 63,061,691	L57P	probably damaging	Het
Phka2	T	A	X: 160,544,295	Y334*	probably null	Het
Plin4	G	T	17: 56,104,112	T973K	possibly damaging	Het
R3hdm4	C	T	10: 79,912,681	R143H	possibly damaging	Het
Rps18	G	C	17: 33,952,273		probably null	Het
Scml4	T	C	10: 42,930,611		probably benign	Het
Slc16a10	A	G	10: 40,141,894	V48A	probably benign	Het
Slc6a5	T	C	7: 49,917,623	V275A	probably benign	Het
Smad9	C	T	3: 54,789,284	R257W	probably damaging	Het
Snrpb	C	A	2: 130,175,379	R73L	probably null	Het
Srsf9	C	T	5: 115,330,512	A69V	probably damaging	Het
Stfa2	A	G	16: 36,404,071	Y90H	probably damaging	Het
Tgm6	T	A	2: 130,151,761	V640E	possibly damaging	Het
Tnrc6c	C	T	11: 117,749,625	R1414C	probably damaging	Het
Tyk2	A	T	9: 21,127,310	C8S	probably damaging	Het
Upp2	G	A	2: 58,790,116	R300Q	possibly damaging	Het
Utp20	A	G	10: 88,757,993		probably benign	Het
Veph1	C	T	3: 66,215,437	V224I	probably benign	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r116	A	G	17: 23,386,051	S113G	probably benign	Het
Vps53	A	C	11: 76,117,783	V237G	probably benign	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCTAGGAAATAGGCCAGATCATC -3'
(R):5'- GTATGATTCTGGTCTAGGAAGGGAC -3'

Sequencing Primer
(F):5'- GGCCAGATCATCCACACTAATATTTC -3'
(R):5'- CATGGAGCTGAAACAGAC -3'

Posted On

2015-02-19