Incidental Mutation 'R3622:Slc6a5'
ID268672
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49917623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 275 (V275A)
Ref Sequence ENSEMBL: ENSMUSP00000146917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably benign
Transcript: ENSMUST00000056442
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: V275A

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107605
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: V275A

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207753
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
R8174:Slc6a5 UTSW 7 49948309 missense probably benign 0.39
R8219:Slc6a5 UTSW 7 49912163 missense probably benign
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCCAGACTTAAGGAGGGACACC -3'
(R):5'- TTGACGTCACCTCTGTGCAC -3'

Sequencing Primer
(F):5'- GGGACACCTACTCCCTCTCATC -3'
(R):5'- CTCTGAGCATCTATTGAATGAACCAC -3'
Posted On2015-02-19