Mutagenetix > Incidental Mutations

Incidental Mutation 'R3622:Slc6a5'

268672

Institutional Source

Beutler Lab

Gene Symbol

Slc6a5

Ensembl Gene

ENSMUSG00000039728

Gene Name

solute carrier family 6 (neurotransmitter transporter, glycine), member 5

Synonyms

Glyt2

MMRRC Submission

040677-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49910146-49963856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49917623 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 275 (V275A)

Ref Sequence

ENSEMBL: ENSMUSP00000146917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]

Predicted Effect

probably benign
Transcript: ENSMUST00000056442
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: V275A

Domain	Start	End	E-Value	Type
Pfam:SNF	185	734	1.6e-218	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107605
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: V275A

Domain	Start	End	E-Value	Type
Pfam:SNF	185	734	1.6e-218	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207753
AA Change: V275A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000209172

Meta Mutation Damage Score

0.1158

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,350,813	Y503*	probably null	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dpf1	G	A	7: 29,316,206		probably null	Het
Grid2ip	T	C	5: 143,386,019	S666P	probably damaging	Het
Gucy2e	T	A	11: 69,225,051	E835V	probably damaging	Het
Hdac5	G	A	11: 102,195,818	P120S	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Ikbkap	A	T	4: 56,759,925		probably null	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Mga	A	G	2: 119,941,764	T1702A	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Muc5b	T	C	7: 141,851,858		probably benign	Het
Olfr1461	T	A	19: 13,165,656	M214K	probably benign	Het
Olfr390	A	G	11: 73,787,741	T268A	probably benign	Het
Olfr912	A	G	9: 38,581,496	Y73C	probably damaging	Het
Olfr994	C	T	2: 85,430,493	C112Y	probably benign	Het
Oma1	T	C	4: 103,366,091	I491T	probably benign	Het
Pbld2	T	C	10: 63,061,691	L57P	probably damaging	Het
Phka2	T	A	X: 160,544,295	Y334*	probably null	Het
Plin4	G	T	17: 56,104,112	T973K	possibly damaging	Het
R3hdm4	C	T	10: 79,912,681	R143H	possibly damaging	Het
Rps18	G	C	17: 33,952,273		probably null	Het
Samd9l	A	T	6: 3,374,032	C1076*	probably null	Het
Scml4	T	C	10: 42,930,611		probably benign	Het
Slc16a10	A	G	10: 40,141,894	V48A	probably benign	Het
Smad9	C	T	3: 54,789,284	R257W	probably damaging	Het
Snrpb	C	A	2: 130,175,379	R73L	probably null	Het
Srsf9	C	T	5: 115,330,512	A69V	probably damaging	Het
Stfa2	A	G	16: 36,404,071	Y90H	probably damaging	Het
Tgm6	T	A	2: 130,151,761	V640E	possibly damaging	Het
Tnrc6c	C	T	11: 117,749,625	R1414C	probably damaging	Het
Tyk2	A	T	9: 21,127,310	C8S	probably damaging	Het
Upp2	G	A	2: 58,790,116	R300Q	possibly damaging	Het
Utp20	A	G	10: 88,757,993		probably benign	Het
Veph1	C	T	3: 66,215,437	V224I	probably benign	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r116	A	G	17: 23,386,051	S113G	probably benign	Het
Vps53	A	C	11: 76,117,783	V237G	probably benign	Het

Other mutations in Slc6a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01373:Slc6a5	APN	7	49917733	missense	probably benign	0.35
IGL01821:Slc6a5	APN	7	49914853	intron	probably benign
R0084:Slc6a5	UTSW	7	49930013	missense	probably benign	0.01
R0266:Slc6a5	UTSW	7	49938408	splice site	probably benign
R0411:Slc6a5	UTSW	7	49911791	missense	probably damaging	1.00
R0621:Slc6a5	UTSW	7	49917365	splice site	probably null
R1649:Slc6a5	UTSW	7	49936262	missense	probably damaging	1.00
R1822:Slc6a5	UTSW	7	49956425	missense	probably benign	0.00
R1889:Slc6a5	UTSW	7	49951434	missense	probably benign	0.03
R2084:Slc6a5	UTSW	7	49948254	missense	probably benign	0.14
R2098:Slc6a5	UTSW	7	49945567	missense	probably damaging	1.00
R2365:Slc6a5	UTSW	7	49946536	missense	possibly damaging	0.93
R2516:Slc6a5	UTSW	7	49956462	missense	probably benign	0.00
R3752:Slc6a5	UTSW	7	49936314	critical splice donor site	probably null
R3848:Slc6a5	UTSW	7	49927558	splice site	probably benign
R3917:Slc6a5	UTSW	7	49911869	missense	probably damaging	1.00
R4617:Slc6a5	UTSW	7	49912020	missense	probably benign	0.00
R4663:Slc6a5	UTSW	7	49938398	nonsense	probably null
R4757:Slc6a5	UTSW	7	49959282	missense	probably benign	0.15
R4916:Slc6a5	UTSW	7	49948256	missense	probably benign	0.00
R5183:Slc6a5	UTSW	7	49936209	missense	probably damaging	0.97
R5257:Slc6a5	UTSW	7	49929992	missense	probably damaging	0.98
R5512:Slc6a5	UTSW	7	49941825	missense	probably damaging	1.00
R5537:Slc6a5	UTSW	7	49959311	missense	probably benign	0.03
R5558:Slc6a5	UTSW	7	49927573	missense	probably benign
R5627:Slc6a5	UTSW	7	49911774	missense	possibly damaging	0.85
R5655:Slc6a5	UTSW	7	49956470	missense	probably benign
R5720:Slc6a5	UTSW	7	49956516	missense	possibly damaging	0.86
R5736:Slc6a5	UTSW	7	49959354	missense	probably benign	0.03
R5817:Slc6a5	UTSW	7	49956491	missense	probably benign	0.00
R5879:Slc6a5	UTSW	7	49945512	missense	probably damaging	1.00
R6033:Slc6a5	UTSW	7	49959351	missense	probably benign	0.01
R6033:Slc6a5	UTSW	7	49959351	missense	probably benign	0.01
R6072:Slc6a5	UTSW	7	49912195	missense	probably damaging	1.00
R6157:Slc6a5	UTSW	7	49951502	missense	probably benign	0.03
R6172:Slc6a5	UTSW	7	49948333	nonsense	probably null
R6414:Slc6a5	UTSW	7	49910243	unclassified	probably benign
R7348:Slc6a5	UTSW	7	49910167	unclassified	probably benign
R7381:Slc6a5	UTSW	7	49930056	missense	probably damaging	1.00
R7486:Slc6a5	UTSW	7	49917330	missense	possibly damaging	0.81
R7624:Slc6a5	UTSW	7	49941866	missense	probably benign	0.00
R7735:Slc6a5	UTSW	7	49948342	critical splice donor site	probably null
R7760:Slc6a5	UTSW	7	49946617	missense	probably benign	0.03
R8174:Slc6a5	UTSW	7	49948309	missense	probably benign	0.39
R8219:Slc6a5	UTSW	7	49912163	missense	probably benign
Z1088:Slc6a5	UTSW	7	49911857	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- TCCAGACTTAAGGAGGGACACC -3'
(R):5'- TTGACGTCACCTCTGTGCAC -3'

Sequencing Primer
(F):5'- GGGACACCTACTCCCTCTCATC -3'
(R):5'- CTCTGAGCATCTATTGAATGAACCAC -3'

Posted On

2015-02-19