Incidental Mutation 'R3622:Pbld2'
ID268679
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
Synonyms3110049J23Rik
MMRRC Submission 040677-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63061691 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 57 (L57P)
Ref Sequence ENSEMBL: ENSMUSP00000151373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020262] [ENSMUST00000020266] [ENSMUST00000178684] [ENSMUST00000219045] [ENSMUST00000219687]
Predicted Effect probably benign
Transcript: ENSMUST00000020262
SMART Domains Protein: ENSMUSP00000020262
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020266
AA Change: L25P

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020266
Gene: ENSMUSG00000112129
AA Change: L25P

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 285 7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155982
Predicted Effect probably benign
Transcript: ENSMUST00000178684
AA Change: L25P

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136589
Gene: ENSMUSG00000112129
AA Change: L25P

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218401
Predicted Effect unknown
Transcript: ENSMUST00000219045
AA Change: L25P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219204
Predicted Effect probably damaging
Transcript: ENSMUST00000219687
AA Change: L57P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0311:Pbld2 UTSW 10 63054507 critical splice donor site probably null
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0727:Pbld2 UTSW 10 63067519 missense probably benign 0.03
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R2251:Pbld2 UTSW 10 63024605 unclassified probably benign
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5508:Pbld2 UTSW 10 63066665 unclassified probably null
R5596:Pbld2 UTSW 10 63072012 missense probably damaging 1.00
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTCTAAAGGTAACCATATTGGCAC -3'
(R):5'- GCCATTCCCTCATAACCTGAAG -3'

Sequencing Primer
(F):5'- GGAACCATTAACTGCACGTCTG -3'
(R):5'- CTGAAGACATGGCCATCAGCG -3'
Posted On2015-02-19