Incidental Mutation 'R3622:R3hdm4'
ID268680
Institutional Source Beutler Lab
Gene Symbol R3hdm4
Ensembl Gene ENSMUSG00000035781
Gene NameR3H domain containing 4
Synonyms
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79910052-79921208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79912681 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 143 (R143H)
Ref Sequence ENSEMBL: ENSMUSP00000132266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000181321] [ENSMUST00000218970] [ENSMUST00000219867]
Predicted Effect probably benign
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045628
AA Change: R143H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781
AA Change: R143H

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171416
AA Change: R143H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781
AA Change: R143H

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in R3hdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:R3hdm4 APN 10 79912091 missense probably damaging 1.00
PIT4472001:R3hdm4 UTSW 10 79913555 critical splice donor site probably null
R0801:R3hdm4 UTSW 10 79913357 unclassified probably benign
R1167:R3hdm4 UTSW 10 79912073 critical splice donor site probably null
R5264:R3hdm4 UTSW 10 79913341 missense probably benign 0.19
R5268:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5269:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5357:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5358:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5360:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5362:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5363:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5434:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5435:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5442:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5534:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5921:R3hdm4 UTSW 10 79913619 missense probably damaging 1.00
R6041:R3hdm4 UTSW 10 79913661 missense possibly damaging 0.46
R7391:R3hdm4 UTSW 10 79911109 missense probably benign 0.00
R7496:R3hdm4 UTSW 10 79916874 missense probably damaging 0.99
R7913:R3hdm4 UTSW 10 79911945 missense probably damaging 1.00
R7983:R3hdm4 UTSW 10 79912723 missense probably damaging 1.00
X0022:R3hdm4 UTSW 10 79913652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGACAGGGTCCTCTGTGAAG -3'
(R):5'- TTTGAAACCCCAGCTCCAG -3'

Sequencing Primer
(F):5'- CTGTGAAGACAGCACGTGG -3'
(R):5'- CAGCTCCAGCATCCAGC -3'
Posted On2015-02-19