Incidental Mutation 'R3622:Midn'
ID268681
Institutional Source Beutler Lab
Gene Symbol Midn
Ensembl Gene ENSMUSG00000035621
Gene Namemidnolin
Synonyms
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3622 (G1)
Quality Score153
Status Not validated
Chromosome10
Chromosomal Location80148272-80158368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80150310 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 78 (D78G)
Ref Sequence ENSEMBL: ENSMUSP00000097091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003156] [ENSMUST00000042057] [ENSMUST00000099492] [ENSMUST00000105366] [ENSMUST00000105367] [ENSMUST00000144526] [ENSMUST00000146516] [ENSMUST00000151202] [ENSMUST00000153477]
Predicted Effect probably benign
Transcript: ENSMUST00000003156
SMART Domains Protein: ENSMUSP00000003156
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042057
AA Change: D78G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046967
Gene: ENSMUSG00000035621
AA Change: D78G

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 130 143 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 238 262 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 434 453 N/A INTRINSIC
low complexity region 465 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099492
AA Change: D78G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097091
Gene: ENSMUSG00000035621
AA Change: D78G

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 154 168 N/A INTRINSIC
low complexity region 195 219 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105366
SMART Domains Protein: ENSMUSP00000101005
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 103 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105367
SMART Domains Protein: ENSMUSP00000101006
Gene: ENSMUSG00000003072

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:ATP-synt_DE_N 38 119 2.2e-21 PFAM
low complexity region 144 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124179
Predicted Effect probably benign
Transcript: ENSMUST00000144526
SMART Domains Protein: ENSMUSP00000120988
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146516
SMART Domains Protein: ENSMUSP00000119962
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 88 112 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151202
SMART Domains Protein: ENSMUSP00000115717
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
Blast:UBQ 32 67 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153477
SMART Domains Protein: ENSMUSP00000119787
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a protein that contains an ubiquitin-like domain. This protein may be involved in the regulation of brain development as inferred by its high expression level in the embryonic midbrain. This protein has been found to negatively regulate glucokinase activity and insulin secretion in pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate and small ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Midn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Midn APN 10 80156643 unclassified probably benign
IGL01969:Midn APN 10 80155259 missense probably benign 0.00
IGL02824:Midn APN 10 80153652 missense possibly damaging 0.91
full_moon UTSW 10 80150112 missense possibly damaging 0.66
Midnight UTSW 10 80154457 missense probably damaging 0.98
Sepia UTSW 10 80151404 missense probably null 0.26
R0684:Midn UTSW 10 80156502 missense probably damaging 1.00
R1517:Midn UTSW 10 80154123 missense probably damaging 0.96
R1926:Midn UTSW 10 80151661 missense probably damaging 1.00
R2004:Midn UTSW 10 80155149 missense probably benign 0.13
R2016:Midn UTSW 10 80150115 missense possibly damaging 0.91
R2340:Midn UTSW 10 80150112 missense possibly damaging 0.66
R2483:Midn UTSW 10 80150310 missense probably benign 0.16
R3624:Midn UTSW 10 80150310 missense probably benign 0.16
R4296:Midn UTSW 10 80151719 missense probably damaging 1.00
R4740:Midn UTSW 10 80151404 missense probably null 0.26
R4930:Midn UTSW 10 80155355 missense probably benign
R4977:Midn UTSW 10 80150184 missense probably damaging 1.00
R5423:Midn UTSW 10 80155193 missense probably benign 0.15
R6149:Midn UTSW 10 80154457 missense probably damaging 0.98
R6542:Midn UTSW 10 80156584 missense probably damaging 0.97
R6826:Midn UTSW 10 80154127 nonsense probably null
R7478:Midn UTSW 10 80155322 missense possibly damaging 0.53
R8025:Midn UTSW 10 80155292 missense probably benign 0.00
X0018:Midn UTSW 10 80153997 missense possibly damaging 0.90
Z1176:Midn UTSW 10 80153628 missense probably benign
Z1177:Midn UTSW 10 80150240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCGGCTAGGATTGGAG -3'
(R):5'- GCTCCTGCCTTTGTGCAGAC -3'

Sequencing Primer
(F):5'- TAGGATTGGAGGCGACCC -3'
(R):5'- GGCCCAAGCAAGTAAGGCC -3'
Posted On2015-02-19