Mutagenetix > Incidental Mutations

Incidental Mutation 'R3622:Utp20'

268682

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

MMRRC Submission

040677-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R3622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 88757993 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]

Predicted Effect

probably benign
Transcript: ENSMUST00000004470

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218967

Predicted Effect

probably benign
Transcript: ENSMUST00000220188

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,350,813	Y503*	probably null	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dpf1	G	A	7: 29,316,206		probably null	Het
Grid2ip	T	C	5: 143,386,019	S666P	probably damaging	Het
Gucy2e	T	A	11: 69,225,051	E835V	probably damaging	Het
Hdac5	G	A	11: 102,195,818	P120S	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Ikbkap	A	T	4: 56,759,925		probably null	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Mga	A	G	2: 119,941,764	T1702A	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Muc5b	T	C	7: 141,851,858		probably benign	Het
Olfr1461	T	A	19: 13,165,656	M214K	probably benign	Het
Olfr390	A	G	11: 73,787,741	T268A	probably benign	Het
Olfr912	A	G	9: 38,581,496	Y73C	probably damaging	Het
Olfr994	C	T	2: 85,430,493	C112Y	probably benign	Het
Oma1	T	C	4: 103,366,091	I491T	probably benign	Het
Pbld2	T	C	10: 63,061,691	L57P	probably damaging	Het
Phka2	T	A	X: 160,544,295	Y334*	probably null	Het
Plin4	G	T	17: 56,104,112	T973K	possibly damaging	Het
R3hdm4	C	T	10: 79,912,681	R143H	possibly damaging	Het
Rps18	G	C	17: 33,952,273		probably null	Het
Samd9l	A	T	6: 3,374,032	C1076*	probably null	Het
Scml4	T	C	10: 42,930,611		probably benign	Het
Slc16a10	A	G	10: 40,141,894	V48A	probably benign	Het
Slc6a5	T	C	7: 49,917,623	V275A	probably benign	Het
Smad9	C	T	3: 54,789,284	R257W	probably damaging	Het
Snrpb	C	A	2: 130,175,379	R73L	probably null	Het
Srsf9	C	T	5: 115,330,512	A69V	probably damaging	Het
Stfa2	A	G	16: 36,404,071	Y90H	probably damaging	Het
Tgm6	T	A	2: 130,151,761	V640E	possibly damaging	Het
Tnrc6c	C	T	11: 117,749,625	R1414C	probably damaging	Het
Tyk2	A	T	9: 21,127,310	C8S	probably damaging	Het
Upp2	G	A	2: 58,790,116	R300Q	possibly damaging	Het
Veph1	C	T	3: 66,215,437	V224I	probably benign	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r116	A	G	17: 23,386,051	S113G	probably benign	Het
Vps53	A	C	11: 76,117,783	V237G	probably benign	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0197:Utp20	UTSW	10	88777516	missense	probably benign	0.22
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2060:Utp20	UTSW	10	88774795	missense	probably damaging	0.98
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3005:Utp20	UTSW	10	88777455	missense	probably damaging	0.97
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4295:Utp20	UTSW	10	88754519	missense	possibly damaging	0.54
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5108:Utp20	UTSW	10	88768873	missense	probably benign	0.00
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7473:Utp20	UTSW	10	88820710	splice site	probably null
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
R7831:Utp20	UTSW	10	88762770	nonsense	probably null
R7833:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7909:Utp20	UTSW	10	88775330	missense	probably benign
R7956:Utp20	UTSW	10	88782614	missense	probably benign	0.23
R7999:Utp20	UTSW	10	88770388	missense	probably benign
R8080:Utp20	UTSW	10	88782715	missense	possibly damaging	0.82
R8098:Utp20	UTSW	10	88752948	missense	probably benign	0.13
R8104:Utp20	UTSW	10	88757904	missense	probably damaging	1.00
R8129:Utp20	UTSW	10	88792625	missense	probably benign	0.29
R8147:Utp20	UTSW	10	88758444	missense	probably benign	0.02
R8199:Utp20	UTSW	10	88798475	missense	probably benign
R8222:Utp20	UTSW	10	88778372	missense	probably damaging	1.00
R8415:Utp20	UTSW	10	88826604	critical splice donor site	probably null
R8466:Utp20	UTSW	10	88818503	missense	probably damaging	1.00
R8505:Utp20	UTSW	10	88818008	missense	probably benign	0.03
R8802:Utp20	UTSW	10	88747295	missense	probably damaging	1.00
R8923:Utp20	UTSW	10	88791742	nonsense	probably null
R8945:Utp20	UTSW	10	88792670	nonsense	probably null
R9065:Utp20	UTSW	10	88757110	missense	probably benign	0.32
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAAGGATCTGATGTGAGTGCAC -3'
(R):5'- CAGTTAAAGCCAGGACCAGC -3'

Sequencing Primer
(F):5'- GTGAGTGCACAAATGTCCAAAAC -3'
(R):5'- CAGTTAGATCCTGCTAAGACTGGTC -3'

Posted On

2015-02-19