Incidental Mutation 'R3622:Gucy2e'
ID 268683
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Name guanylate cyclase 2e
Synonyms GC1, ROS-GC1, GC-E
MMRRC Submission 040677-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R3622 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69108943-69127862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69115877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 835 (E835V)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
AlphaFold P52785
Predicted Effect probably damaging
Transcript: ENSMUST00000021259
AA Change: E835V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: E835V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108664
AA Change: E835V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: E835V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108665
AA Change: E835V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: E835V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Meta Mutation Damage Score 0.4132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,950,036 (GRCm39) Y503* probably null Het
Akap9 C A 5: 4,026,235 (GRCm39) Q1297K possibly damaging Het
Dffb T C 4: 154,049,976 (GRCm39) T296A probably damaging Het
Dpf1 G A 7: 29,015,631 (GRCm39) probably null Het
Elp1 A T 4: 56,759,925 (GRCm39) probably null Het
Grid2ip T C 5: 143,371,774 (GRCm39) S666P probably damaging Het
Hdac5 G A 11: 102,086,644 (GRCm39) P120S probably benign Het
Htr1d T C 4: 136,170,815 (GRCm39) I348T probably damaging Het
Hyal4 A T 6: 24,765,737 (GRCm39) S364C probably damaging Het
Igkv1-133 A T 6: 67,701,944 (GRCm39) Q16L probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Met A T 6: 17,549,085 (GRCm39) D979V probably damaging Het
Mga A G 2: 119,772,245 (GRCm39) T1702A probably damaging Het
Midn A G 10: 79,986,144 (GRCm39) D78G probably benign Het
Muc5b T C 7: 141,405,595 (GRCm39) probably benign Het
Oma1 T C 4: 103,223,288 (GRCm39) I491T probably benign Het
Or1e30 A G 11: 73,678,567 (GRCm39) T268A probably benign Het
Or5ak24 C T 2: 85,260,837 (GRCm39) C112Y probably benign Het
Or5b107 T A 19: 13,143,020 (GRCm39) M214K probably benign Het
Or8b48 A G 9: 38,492,792 (GRCm39) Y73C probably damaging Het
Pbld2 T C 10: 62,897,470 (GRCm39) L57P probably damaging Het
Phka2 T A X: 159,327,291 (GRCm39) Y334* probably null Het
Plin4 G T 17: 56,411,112 (GRCm39) T973K possibly damaging Het
R3hdm4 C T 10: 79,748,515 (GRCm39) R143H possibly damaging Het
Rps18 G C 17: 34,171,247 (GRCm39) probably null Het
Samd9l A T 6: 3,374,032 (GRCm39) C1076* probably null Het
Scml4 T C 10: 42,806,607 (GRCm39) probably benign Het
Slc16a10 A G 10: 40,017,890 (GRCm39) V48A probably benign Het
Slc6a5 T C 7: 49,567,371 (GRCm39) V275A probably benign Het
Smad9 C T 3: 54,696,705 (GRCm39) R257W probably damaging Het
Snrpb C A 2: 130,017,299 (GRCm39) R73L probably null Het
Srsf9 C T 5: 115,468,571 (GRCm39) A69V probably damaging Het
Stfa2 A G 16: 36,224,433 (GRCm39) Y90H probably damaging Het
Tgm6 T A 2: 129,993,681 (GRCm39) V640E possibly damaging Het
Tnrc6c C T 11: 117,640,451 (GRCm39) R1414C probably damaging Het
Tyk2 A T 9: 21,038,606 (GRCm39) C8S probably damaging Het
Upp2 G A 2: 58,680,128 (GRCm39) R300Q possibly damaging Het
Utp20 A G 10: 88,593,855 (GRCm39) probably benign Het
Veph1 C T 3: 66,122,858 (GRCm39) V224I probably benign Het
Vmn1r30 A T 6: 58,412,437 (GRCm39) F132I probably benign Het
Vmn2r116 A G 17: 23,605,025 (GRCm39) S113G probably benign Het
Vps53 A C 11: 76,008,609 (GRCm39) V237G probably benign Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69,113,923 (GRCm39) missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69,123,681 (GRCm39) missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69,123,678 (GRCm39) missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69,114,642 (GRCm39) missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69,123,613 (GRCm39) missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69,126,942 (GRCm39) missense probably benign
IGL02622:Gucy2e APN 11 69,115,857 (GRCm39) missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69,122,833 (GRCm39) missense probably benign 0.18
IGL03181:Gucy2e APN 11 69,121,008 (GRCm39) splice site probably benign
R0110:Gucy2e UTSW 11 69,126,402 (GRCm39) missense probably benign 0.00
R0115:Gucy2e UTSW 11 69,127,458 (GRCm39) missense unknown
R0450:Gucy2e UTSW 11 69,126,402 (GRCm39) missense probably benign 0.00
R0469:Gucy2e UTSW 11 69,126,402 (GRCm39) missense probably benign 0.00
R0497:Gucy2e UTSW 11 69,114,985 (GRCm39) missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69,126,402 (GRCm39) missense probably benign 0.00
R1252:Gucy2e UTSW 11 69,126,485 (GRCm39) missense probably benign
R1535:Gucy2e UTSW 11 69,117,070 (GRCm39) missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69,122,884 (GRCm39) missense probably benign
R2035:Gucy2e UTSW 11 69,118,358 (GRCm39) missense probably benign 0.12
R2179:Gucy2e UTSW 11 69,119,404 (GRCm39) splice site probably null
R4212:Gucy2e UTSW 11 69,118,949 (GRCm39) missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69,126,994 (GRCm39) missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69,119,274 (GRCm39) missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69,126,396 (GRCm39) missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69,127,392 (GRCm39) missense probably benign
R5440:Gucy2e UTSW 11 69,114,472 (GRCm39) missense probably damaging 0.98
R5586:Gucy2e UTSW 11 69,117,082 (GRCm39) missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69,119,207 (GRCm39) missense probably damaging 1.00
R5820:Gucy2e UTSW 11 69,123,522 (GRCm39) missense probably benign 0.36
R5826:Gucy2e UTSW 11 69,126,859 (GRCm39) missense possibly damaging 0.53
R6169:Gucy2e UTSW 11 69,126,930 (GRCm39) missense probably benign 0.19
R6544:Gucy2e UTSW 11 69,126,483 (GRCm39) missense probably benign
R6815:Gucy2e UTSW 11 69,122,827 (GRCm39) missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69,123,619 (GRCm39) missense probably benign 0.00
R7592:Gucy2e UTSW 11 69,114,150 (GRCm39) critical splice donor site probably null
R7658:Gucy2e UTSW 11 69,117,055 (GRCm39) nonsense probably null
R7812:Gucy2e UTSW 11 69,117,069 (GRCm39) missense probably damaging 1.00
R8284:Gucy2e UTSW 11 69,123,177 (GRCm39) missense probably benign
R8479:Gucy2e UTSW 11 69,123,789 (GRCm39) missense probably benign 0.22
R8537:Gucy2e UTSW 11 69,127,179 (GRCm39) missense probably benign 0.01
R8806:Gucy2e UTSW 11 69,126,942 (GRCm39) missense probably benign
R9030:Gucy2e UTSW 11 69,115,827 (GRCm39) missense probably damaging 1.00
R9192:Gucy2e UTSW 11 69,127,303 (GRCm39) missense probably damaging 1.00
R9217:Gucy2e UTSW 11 69,126,778 (GRCm39) missense possibly damaging 0.63
R9304:Gucy2e UTSW 11 69,126,560 (GRCm39) missense probably benign 0.20
R9566:Gucy2e UTSW 11 69,118,947 (GRCm39) missense probably damaging 1.00
R9784:Gucy2e UTSW 11 69,123,516 (GRCm39) missense probably benign
X0025:Gucy2e UTSW 11 69,117,070 (GRCm39) missense probably damaging 1.00
Z1186:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1186:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1187:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1187:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1188:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1188:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1189:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1189:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1190:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1190:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1191:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1191:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Z1192:Gucy2e UTSW 11 69,127,429 (GRCm39) missense unknown
Z1192:Gucy2e UTSW 11 69,114,431 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACAGATCTAGGAATGGTGAA -3'
(R):5'- CCAGCTTTCTTGTTGATGTCG -3'

Sequencing Primer
(F):5'- TGAACAGCGGGGGTTACC -3'
(R):5'- GGAGGAAGTCCAGCTCTATTCTC -3'
Posted On 2015-02-19