Incidental Mutation 'R3622:Vps53'
ID268685
Institutional Source Beutler Lab
Gene Symbol Vps53
Ensembl Gene ENSMUSG00000017288
Gene NameVPS53 GARP complex subunit
Synonyms2310040I21Rik, 3100002B05Rik, 2010002A08Rik
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76046226-76179647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76117783 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 237 (V237G)
Ref Sequence ENSEMBL: ENSMUSP00000130499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056601] [ENSMUST00000094015] [ENSMUST00000108419] [ENSMUST00000163878] [ENSMUST00000166752] [ENSMUST00000167114] [ENSMUST00000169734]
Predicted Effect probably benign
Transcript: ENSMUST00000056601
AA Change: V237G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061317
Gene: ENSMUSG00000017288
AA Change: V237G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 5.9e-11 PFAM
Pfam:Vps53_N 39 453 1.9e-176 PFAM
low complexity region 520 533 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094015
AA Change: V208G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091554
Gene: ENSMUSG00000017288
AA Change: V208G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 96 6.2e-21 PFAM
Pfam:Vps53_N 93 424 1.4e-133 PFAM
low complexity region 491 504 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108419
SMART Domains Protein: ENSMUSP00000104057
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 224 4e-11 PFAM
Pfam:Vps53_N 39 233 5.2e-87 PFAM
Pfam:Vps53_N 226 276 1.6e-14 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 643 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141773
Predicted Effect probably benign
Transcript: ENSMUST00000163878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166084
Predicted Effect unknown
Transcript: ENSMUST00000166436
AA Change: V167G
SMART Domains Protein: ENSMUSP00000131387
Gene: ENSMUSG00000017288
AA Change: V167G

DomainStartEndE-ValueType
Pfam:DUF2450 1 155 1.6e-8 PFAM
Pfam:Vps53_N 1 204 6.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166752
SMART Domains Protein: ENSMUSP00000129159
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 8.2e-12 PFAM
Pfam:Vps53_N 39 230 6e-87 PFAM
Pfam:Vps53_N 226 405 1.4e-60 PFAM
low complexity region 472 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167114
SMART Domains Protein: ENSMUSP00000131663
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 101 1.2e-21 PFAM
Pfam:Vps53_N 104 176 3.1e-15 PFAM
low complexity region 243 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably benign
Transcript: ENSMUST00000169734
AA Change: V237G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130499
Gene: ENSMUSG00000017288
AA Change: V237G

DomainStartEndE-ValueType
Pfam:DUF2450 5 225 5.1e-12 PFAM
Pfam:Vps53_N 39 329 1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170143
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E12.5 with trophoblast cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Other mutations in Vps53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Vps53 APN 11 76077035 splice site probably null
IGL01596:Vps53 APN 11 76063037 missense probably damaging 1.00
IGL01655:Vps53 APN 11 76063034 missense probably damaging 0.97
IGL02275:Vps53 APN 11 76047123 missense probably benign 0.03
IGL02321:Vps53 APN 11 76048538 missense possibly damaging 0.60
IGL02581:Vps53 APN 11 76102057 missense probably damaging 0.99
IGL02821:Vps53 APN 11 76136317 splice site probably benign
IGL02958:Vps53 APN 11 76117711 missense probably damaging 1.00
IGL03001:Vps53 APN 11 76138324 missense probably damaging 1.00
PIT4519001:Vps53 UTSW 11 76117173 missense probably damaging 1.00
R0257:Vps53 UTSW 11 76177385 intron probably benign
R0391:Vps53 UTSW 11 76121579 missense probably benign 0.31
R0421:Vps53 UTSW 11 76082670 missense probably damaging 1.00
R0882:Vps53 UTSW 11 76082659 missense probably damaging 1.00
R2509:Vps53 UTSW 11 76066835 missense possibly damaging 0.49
R5137:Vps53 UTSW 11 76166248 missense probably damaging 1.00
R5338:Vps53 UTSW 11 76081208 missense probably damaging 1.00
R5756:Vps53 UTSW 11 76092330 splice site probably benign
R5786:Vps53 UTSW 11 76063007 missense probably benign 0.08
R5961:Vps53 UTSW 11 76048490 missense probably damaging 1.00
R6059:Vps53 UTSW 11 76066867 missense possibly damaging 0.57
R6273:Vps53 UTSW 11 76102018 missense probably benign 0.16
R6490:Vps53 UTSW 11 76077055 missense probably benign 0.03
R6657:Vps53 UTSW 11 76134427 missense probably damaging 1.00
R6671:Vps53 UTSW 11 76134506 missense probably damaging 1.00
R6772:Vps53 UTSW 11 76179498 start codon destroyed probably null
R7378:Vps53 UTSW 11 76077074 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGGAGGAAGGCAACATTAGTTTC -3'
(R):5'- GGTTGGCTACTGCAAGACTAG -3'

Sequencing Primer
(F):5'- GGAAGGCAACATTAGTTTCTTTTTC -3'
(R):5'- GGCTACTGCAAGACTAGCTTAATG -3'
Posted On2015-02-19