Incidental Mutation 'R3622:Tnrc6c'
ID 268686
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Name trinucleotide repeat containing 6C
Synonyms 9930033H14Rik
MMRRC Submission 040677-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3622 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 117545115-117654265 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 117640451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1414 (R1414C)
Ref Sequence ENSEMBL: ENSMUSP00000101951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026658
AA Change: R1414C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: R1414C

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106344
AA Change: R1414C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: R1414C

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138299
AA Change: R1246C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: R1246C

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141287
Meta Mutation Damage Score 0.1566 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,950,036 (GRCm39) Y503* probably null Het
Akap9 C A 5: 4,026,235 (GRCm39) Q1297K possibly damaging Het
Dffb T C 4: 154,049,976 (GRCm39) T296A probably damaging Het
Dpf1 G A 7: 29,015,631 (GRCm39) probably null Het
Elp1 A T 4: 56,759,925 (GRCm39) probably null Het
Grid2ip T C 5: 143,371,774 (GRCm39) S666P probably damaging Het
Gucy2e T A 11: 69,115,877 (GRCm39) E835V probably damaging Het
Hdac5 G A 11: 102,086,644 (GRCm39) P120S probably benign Het
Htr1d T C 4: 136,170,815 (GRCm39) I348T probably damaging Het
Hyal4 A T 6: 24,765,737 (GRCm39) S364C probably damaging Het
Igkv1-133 A T 6: 67,701,944 (GRCm39) Q16L probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Met A T 6: 17,549,085 (GRCm39) D979V probably damaging Het
Mga A G 2: 119,772,245 (GRCm39) T1702A probably damaging Het
Midn A G 10: 79,986,144 (GRCm39) D78G probably benign Het
Muc5b T C 7: 141,405,595 (GRCm39) probably benign Het
Oma1 T C 4: 103,223,288 (GRCm39) I491T probably benign Het
Or1e30 A G 11: 73,678,567 (GRCm39) T268A probably benign Het
Or5ak24 C T 2: 85,260,837 (GRCm39) C112Y probably benign Het
Or5b107 T A 19: 13,143,020 (GRCm39) M214K probably benign Het
Or8b48 A G 9: 38,492,792 (GRCm39) Y73C probably damaging Het
Pbld2 T C 10: 62,897,470 (GRCm39) L57P probably damaging Het
Phka2 T A X: 159,327,291 (GRCm39) Y334* probably null Het
Plin4 G T 17: 56,411,112 (GRCm39) T973K possibly damaging Het
R3hdm4 C T 10: 79,748,515 (GRCm39) R143H possibly damaging Het
Rps18 G C 17: 34,171,247 (GRCm39) probably null Het
Samd9l A T 6: 3,374,032 (GRCm39) C1076* probably null Het
Scml4 T C 10: 42,806,607 (GRCm39) probably benign Het
Slc16a10 A G 10: 40,017,890 (GRCm39) V48A probably benign Het
Slc6a5 T C 7: 49,567,371 (GRCm39) V275A probably benign Het
Smad9 C T 3: 54,696,705 (GRCm39) R257W probably damaging Het
Snrpb C A 2: 130,017,299 (GRCm39) R73L probably null Het
Srsf9 C T 5: 115,468,571 (GRCm39) A69V probably damaging Het
Stfa2 A G 16: 36,224,433 (GRCm39) Y90H probably damaging Het
Tgm6 T A 2: 129,993,681 (GRCm39) V640E possibly damaging Het
Tyk2 A T 9: 21,038,606 (GRCm39) C8S probably damaging Het
Upp2 G A 2: 58,680,128 (GRCm39) R300Q possibly damaging Het
Utp20 A G 10: 88,593,855 (GRCm39) probably benign Het
Veph1 C T 3: 66,122,858 (GRCm39) V224I probably benign Het
Vmn1r30 A T 6: 58,412,437 (GRCm39) F132I probably benign Het
Vmn2r116 A G 17: 23,605,025 (GRCm39) S113G probably benign Het
Vps53 A C 11: 76,008,609 (GRCm39) V237G probably benign Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117,605,011 (GRCm39) missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117,612,855 (GRCm39) missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117,612,811 (GRCm39) missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117,605,083 (GRCm39) missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117,613,939 (GRCm39) missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117,640,161 (GRCm39) splice site probably benign
IGL01869:Tnrc6c APN 11 117,646,274 (GRCm39) missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117,612,025 (GRCm39) missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117,613,803 (GRCm39) missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117,633,826 (GRCm39) missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117,622,996 (GRCm39) missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117,640,651 (GRCm39) splice site probably benign
rodion UTSW 11 117,629,176 (GRCm39) critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117,651,564 (GRCm39) missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117,612,284 (GRCm39) missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117,643,811 (GRCm39) missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117,630,707 (GRCm39) missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117,630,707 (GRCm39) missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117,651,375 (GRCm39) missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117,613,447 (GRCm39) missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117,612,748 (GRCm39) missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117,612,500 (GRCm39) missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117,624,529 (GRCm39) missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117,650,463 (GRCm39) missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117,648,867 (GRCm39) missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117,651,556 (GRCm39) missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117,605,188 (GRCm39) missense probably benign
R1901:Tnrc6c UTSW 11 117,613,831 (GRCm39) missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117,646,849 (GRCm39) missense possibly damaging 0.91
R3711:Tnrc6c UTSW 11 117,613,950 (GRCm39) missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117,614,055 (GRCm39) missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117,646,309 (GRCm39) missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117,614,355 (GRCm39) missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117,613,324 (GRCm39) missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117,633,784 (GRCm39) missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117,633,784 (GRCm39) missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117,611,797 (GRCm39) missense probably benign
R4765:Tnrc6c UTSW 11 117,633,753 (GRCm39) missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117,613,731 (GRCm39) missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117,611,872 (GRCm39) missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117,611,872 (GRCm39) missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117,629,176 (GRCm39) critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117,651,555 (GRCm39) missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117,651,555 (GRCm39) missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117,614,113 (GRCm39) missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117,649,731 (GRCm39) splice site silent
R5428:Tnrc6c UTSW 11 117,591,588 (GRCm39) start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117,651,669 (GRCm39) missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117,640,097 (GRCm39) nonsense probably null
R5875:Tnrc6c UTSW 11 117,650,534 (GRCm39) missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117,613,345 (GRCm39) missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117,626,831 (GRCm39) missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117,640,440 (GRCm39) missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117,613,567 (GRCm39) missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117,624,444 (GRCm39) missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117,612,800 (GRCm39) missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117,604,952 (GRCm39) missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117,614,354 (GRCm39) missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117,632,606 (GRCm39) missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117,612,780 (GRCm39) missense probably benign
R7515:Tnrc6c UTSW 11 117,632,507 (GRCm39) missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117,611,777 (GRCm39) missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117,648,912 (GRCm39) missense probably benign 0.00
R8679:Tnrc6c UTSW 11 117,604,961 (GRCm39) missense probably benign
R8824:Tnrc6c UTSW 11 117,630,680 (GRCm39) splice site probably benign
R8971:Tnrc6c UTSW 11 117,640,089 (GRCm39) missense possibly damaging 0.95
R9261:Tnrc6c UTSW 11 117,605,105 (GRCm39) missense probably damaging 0.99
R9283:Tnrc6c UTSW 11 117,591,630 (GRCm39) missense unknown
R9342:Tnrc6c UTSW 11 117,630,720 (GRCm39) missense probably benign 0.01
R9633:Tnrc6c UTSW 11 117,638,009 (GRCm39) missense probably damaging 1.00
R9761:Tnrc6c UTSW 11 117,623,136 (GRCm39) missense probably benign
V7580:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117,614,152 (GRCm39) missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117,623,003 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTAGTAGAGGAGACCCCAGTGG -3'
(R):5'- TTGGGTGAAGACTGCTGCTC -3'

Sequencing Primer
(F):5'- ACTCCCTGTGTGGAAAGTCC -3'
(R):5'- AAGACTGCTGCTCTTTGGTC -3'
Posted On 2015-02-19