Incidental Mutation 'R3623:Hyal4'
ID 268713
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms 4632428M18Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3623 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 24748366-24766518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24765737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 364 (S364C)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect probably damaging
Transcript: ENSMUST00000031691
AA Change: S364C

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: S364C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Meta Mutation Damage Score 0.5393 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,080,348 (GRCm39) T364A probably benign Het
Adpgk G A 9: 59,221,036 (GRCm39) V281I probably benign Het
Akap9 C A 5: 4,026,235 (GRCm39) Q1297K possibly damaging Het
Ankrd13d T C 19: 4,331,968 (GRCm39) E110G probably damaging Het
Ankrd53 A G 6: 83,740,244 (GRCm39) E104G possibly damaging Het
Becn2 T C 1: 175,748,197 (GRCm39) C88R possibly damaging Het
Bscl2 T A 19: 8,818,514 (GRCm39) C40S probably benign Het
Btaf1 A G 19: 36,958,486 (GRCm39) T668A probably benign Het
Camk2g G A 14: 20,805,775 (GRCm39) probably benign Het
Cd109 A T 9: 78,574,639 (GRCm39) D541V probably damaging Het
Cep135 G A 5: 76,772,586 (GRCm39) G657D probably benign Het
Coch A G 12: 51,649,609 (GRCm39) I307V probably benign Het
D17H6S53E A G 17: 35,346,512 (GRCm39) E141G probably benign Het
Ddias T C 7: 92,508,800 (GRCm39) T372A probably benign Het
Dffb T C 4: 154,049,976 (GRCm39) T296A probably damaging Het
Dock8 A G 19: 25,057,241 (GRCm39) Q216R probably benign Het
Ep400 T C 5: 110,867,102 (GRCm39) Y1014C unknown Het
Ephx1 A G 1: 180,817,498 (GRCm39) I391T probably benign Het
Fcgbp A G 7: 27,800,701 (GRCm39) Y1249C probably damaging Het
Gm5592 T C 7: 40,807,052 (GRCm39) probably benign Het
Gm7964 A G 7: 83,405,629 (GRCm39) N149S probably benign Het
Greb1l T A 18: 10,542,380 (GRCm39) I1325N probably damaging Het
H2-T3 T C 17: 36,500,957 (GRCm39) T20A possibly damaging Het
Htr1d T C 4: 136,170,815 (GRCm39) I348T probably damaging Het
Igkv1-133 A T 6: 67,701,944 (GRCm39) Q16L probably benign Het
Irs2 C T 8: 11,057,643 (GRCm39) G263D probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kmt2a A G 9: 44,760,263 (GRCm39) Y529H probably damaging Het
Mdfic T A 6: 15,770,319 (GRCm39) N108K probably damaging Het
Met A T 6: 17,549,085 (GRCm39) D979V probably damaging Het
Mettl21e T A 1: 44,245,857 (GRCm39) I130F probably damaging Het
Mlh3 C T 12: 85,315,169 (GRCm39) C339Y probably damaging Het
Mog T C 17: 37,323,338 (GRCm39) H200R possibly damaging Het
Msrb3 C T 10: 120,620,103 (GRCm39) R72H probably damaging Het
Mtmr11 A G 3: 96,072,583 (GRCm39) H324R probably damaging Het
Myh7 T C 14: 55,210,838 (GRCm39) E1693G probably damaging Het
Nadk2 T A 15: 9,084,303 (GRCm39) W139R probably damaging Het
Ndufa9 A T 6: 126,821,362 (GRCm39) M76K possibly damaging Het
Nr1i2 A G 16: 38,086,269 (GRCm39) probably benign Het
Nsd3 A G 8: 26,152,835 (GRCm39) T392A probably damaging Het
Or14a259 A G 7: 86,013,308 (GRCm39) F79S probably benign Het
Or52d3 T C 7: 104,229,149 (GRCm39) S99P probably damaging Het
P2ry2 A T 7: 100,647,706 (GRCm39) S200T probably benign Het
Pcnt T A 10: 76,269,584 (GRCm39) E228V probably benign Het
Phka2 T A X: 159,327,291 (GRCm39) Y334* probably null Het
Pkhd1l1 A T 15: 44,390,265 (GRCm39) K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,429 (GRCm39) noncoding transcript Het
Rspry1 A G 8: 95,376,405 (GRCm39) D309G probably damaging Het
Scap A G 9: 110,209,271 (GRCm39) Y648C probably damaging Het
Sgcz T C 8: 38,420,201 (GRCm39) E17G probably damaging Het
Slc17a5 A T 9: 78,445,556 (GRCm39) V433D probably damaging Het
Smad9 C T 3: 54,696,705 (GRCm39) R257W probably damaging Het
Srcap T C 7: 127,141,319 (GRCm39) S1639P probably damaging Het
Strn3 T C 12: 51,707,999 (GRCm39) Y132C possibly damaging Het
Tas2r110 A T 6: 132,845,433 (GRCm39) M155L probably benign Het
Tasor2 T C 13: 3,645,556 (GRCm39) T98A probably benign Het
Thbd A G 2: 148,248,893 (GRCm39) V325A probably damaging Het
Trpd52l3 T A 19: 29,981,333 (GRCm39) C29* probably null Het
Trpm1 A G 7: 63,894,601 (GRCm39) Y951C probably damaging Het
Ube3a T A 7: 58,921,860 (GRCm39) N77K probably damaging Het
Upp2 G A 2: 58,680,128 (GRCm39) R300Q possibly damaging Het
Usp35 T C 7: 96,961,827 (GRCm39) H533R probably damaging Het
Veph1 C T 3: 66,122,858 (GRCm39) V224I probably benign Het
Vmn1r30 A T 6: 58,412,437 (GRCm39) F132I probably benign Het
Vmn2r24 A G 6: 123,792,997 (GRCm39) R775G probably damaging Het
Vps13c T A 9: 67,883,189 (GRCm39) probably null Het
Vps37c T A 19: 10,683,569 (GRCm39) probably null Het
Zap70 C T 1: 36,818,216 (GRCm39) T301I probably benign Het
Zfp341 A G 2: 154,466,801 (GRCm39) K57E probably damaging Het
Zfp60 T A 7: 27,448,753 (GRCm39) F474I probably benign Het
Zfp786 T C 6: 47,798,357 (GRCm39) N194D probably benign Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24,755,871 (GRCm39) missense probably benign 0.03
IGL01791:Hyal4 APN 6 24,763,894 (GRCm39) splice site probably benign
IGL02434:Hyal4 APN 6 24,763,857 (GRCm39) nonsense probably null
IGL02523:Hyal4 APN 6 24,765,968 (GRCm39) missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24,755,964 (GRCm39) missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24,765,714 (GRCm39) missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24,755,833 (GRCm39) missense probably benign 0.05
R0196:Hyal4 UTSW 6 24,756,220 (GRCm39) missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24,756,193 (GRCm39) missense probably benign 0.30
R0398:Hyal4 UTSW 6 24,756,670 (GRCm39) missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24,755,912 (GRCm39) nonsense probably null
R0961:Hyal4 UTSW 6 24,755,745 (GRCm39) utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24,756,110 (GRCm39) missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24,756,310 (GRCm39) missense probably benign 0.00
R2085:Hyal4 UTSW 6 24,755,749 (GRCm39) start gained probably benign
R2483:Hyal4 UTSW 6 24,765,737 (GRCm39) missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24,765,737 (GRCm39) missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24,765,737 (GRCm39) missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24,756,513 (GRCm39) missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24,756,223 (GRCm39) missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24,765,861 (GRCm39) missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24,766,089 (GRCm39) nonsense probably null
R6442:Hyal4 UTSW 6 24,765,849 (GRCm39) missense probably benign 0.08
R6494:Hyal4 UTSW 6 24,765,745 (GRCm39) missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24,756,190 (GRCm39) missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24,765,933 (GRCm39) missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24,755,785 (GRCm39) start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24,763,865 (GRCm39) missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24,763,865 (GRCm39) missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24,755,995 (GRCm39) missense probably benign 0.14
R8676:Hyal4 UTSW 6 24,755,826 (GRCm39) missense probably damaging 0.99
R9331:Hyal4 UTSW 6 24,765,866 (GRCm39) missense probably damaging 1.00
R9573:Hyal4 UTSW 6 24,756,508 (GRCm39) missense possibly damaging 0.62
Z1176:Hyal4 UTSW 6 24,756,627 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCGATCTGAGACCTTTGTG -3'
(R):5'- ATTCTCTGCCATCACAGCTAGG -3'

Sequencing Primer
(F):5'- CCGATCTGAGACCTTTGTGTTACAG -3'
(R):5'- CATCACAGCTAGGTCAGTGTCTG -3'
Posted On 2015-02-19