Incidental Mutation 'R3623:Gm5592'
ID268722
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 41157628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000206490]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108009
SMART Domains Protein: ENSMUSP00000103644
Gene: ENSMUSG00000078737

DomainStartEndE-ValueType
Pfam:DUF4629 425 524 5.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCCAGTGGTTCAAATGGAGAC -3'
(R):5'- TAGCCCCACAAGCTCTTTCG -3'

Sequencing Primer
(F):5'- TTCAAATGGAGACGTCCCTG -3'
(R):5'- GGGCATTATCAGAATCAGGCTTC -3'
Posted On2015-02-19