Incidental Mutation 'R3623:P2ry2'
ID268728
Institutional Source Beutler Lab
Gene Symbol P2ry2
Ensembl Gene ENSMUSG00000032860
Gene Namepurinergic receptor P2Y, G-protein coupled 2
SynonymsP2Y2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100996568-101012866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100998499 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 200 (S200T)
Ref Sequence ENSEMBL: ENSMUSP00000146679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037540] [ENSMUST00000178340] [ENSMUST00000207049] [ENSMUST00000207916] [ENSMUST00000208340]
Predicted Effect probably benign
Transcript: ENSMUST00000037540
AA Change: S200T

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036765
Gene: ENSMUSG00000032860
AA Change: S200T

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 3.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178340
AA Change: S200T

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137152
Gene: ENSMUSG00000032860
AA Change: S200T

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207049
Predicted Effect probably benign
Transcript: ENSMUST00000207916
AA Change: S200T

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208340
AA Change: S200T

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display reduced nucleotide-stimulated calcium secretion from lung fibroblasts and nasal and tracheal epithelial cells and chloride secretion from trachea and gallbladder. Induction of neuronal differentiationby ATPgammaS is abolished. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in P2ry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:P2ry2 APN 7 100998186 missense probably damaging 0.99
IGL02221:P2ry2 APN 7 100998114 missense possibly damaging 0.86
R0567:P2ry2 UTSW 7 100998541 missense probably damaging 1.00
R1882:P2ry2 UTSW 7 100998851 nonsense probably null
R2483:P2ry2 UTSW 7 100998499 missense probably benign 0.12
R4193:P2ry2 UTSW 7 100998450 missense probably benign 0.01
R4559:P2ry2 UTSW 7 100998156 missense possibly damaging 0.89
R5161:P2ry2 UTSW 7 100998929 nonsense probably null
R6021:P2ry2 UTSW 7 100998400 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTGAGGTCAAGTGATCG -3'
(R):5'- ACTGGCCATTTAGCACGGTG -3'

Sequencing Primer
(F):5'- CTGAGGTCAAGTGATCGGAAGG -3'
(R):5'- TCACCTGCATCAGCGTG -3'
Posted On2015-02-19