Incidental Mutation 'R3623:Ankrd13d'
ID268760
Institutional Source Beutler Lab
Gene Symbol Ankrd13d
Ensembl Gene ENSMUSG00000005986
Gene Nameankyrin repeat domain 13 family, member D
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4270180-4283137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4281940 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 110 (E110G)
Ref Sequence ENSEMBL: ENSMUSP00000128037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000056888] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000163858] [ENSMUST00000167215] [ENSMUST00000169192] [ENSMUST00000171123]
Predicted Effect probably benign
Transcript: ENSMUST00000025791
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056888
AA Change: E110G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986
AA Change: E110G

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088737
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167215
AA Change: E110G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128037
Gene: ENSMUSG00000005986
AA Change: E110G

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169192
AA Change: E37G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986
AA Change: E37G

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169653
Predicted Effect probably benign
Transcript: ENSMUST00000170283
SMART Domains Protein: ENSMUSP00000126349
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 98 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171123
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat domain (ANKRD) 13 family, which currently consists of four proteins containing ubiquitin-interacting motifs. These proteins are integral membrane proteins that bind specifically to Lys-63-linked ubiquitin chains on membrane-bound proteins, targeting those proteins for rapid internalization. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Ankrd13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Ankrd13d APN 19 4273564 missense probably benign 0.21
IGL02480:Ankrd13d APN 19 4271463 missense possibly damaging 0.67
R0639:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R0673:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R1423:Ankrd13d UTSW 19 4281069 missense probably damaging 1.00
R1592:Ankrd13d UTSW 19 4282891 missense probably benign 0.21
R1682:Ankrd13d UTSW 19 4282933 missense probably damaging 1.00
R1843:Ankrd13d UTSW 19 4271595 missense probably damaging 0.99
R2277:Ankrd13d UTSW 19 4280984 missense probably benign 0.03
R2376:Ankrd13d UTSW 19 4272595 missense possibly damaging 0.79
R2483:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R4066:Ankrd13d UTSW 19 4270360 missense probably benign 0.00
R5871:Ankrd13d UTSW 19 4281994 missense possibly damaging 0.92
R6011:Ankrd13d UTSW 19 4281934 missense probably damaging 1.00
R6057:Ankrd13d UTSW 19 4282228 missense probably damaging 0.97
R6167:Ankrd13d UTSW 19 4273053 missense probably damaging 1.00
R7747:Ankrd13d UTSW 19 4280985 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGACCCAGTCTCATCTGCATG -3'
(R):5'- AGACTAGCTTCCAGGTTGGTG -3'

Sequencing Primer
(F):5'- ATGGGCCTGGGATCCCATATTTC -3'
(R):5'- ACTAGCTTCCAGGTTGGTGAATGG -3'
Posted On2015-02-19