Incidental Mutation 'R3623:Dock8'
ID 268763
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R3623 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25057241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 216 (Q216R)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: Q216R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: Q216R

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,080,348 (GRCm39) T364A probably benign Het
Adpgk G A 9: 59,221,036 (GRCm39) V281I probably benign Het
Akap9 C A 5: 4,026,235 (GRCm39) Q1297K possibly damaging Het
Ankrd13d T C 19: 4,331,968 (GRCm39) E110G probably damaging Het
Ankrd53 A G 6: 83,740,244 (GRCm39) E104G possibly damaging Het
Becn2 T C 1: 175,748,197 (GRCm39) C88R possibly damaging Het
Bscl2 T A 19: 8,818,514 (GRCm39) C40S probably benign Het
Btaf1 A G 19: 36,958,486 (GRCm39) T668A probably benign Het
Camk2g G A 14: 20,805,775 (GRCm39) probably benign Het
Cd109 A T 9: 78,574,639 (GRCm39) D541V probably damaging Het
Cep135 G A 5: 76,772,586 (GRCm39) G657D probably benign Het
Coch A G 12: 51,649,609 (GRCm39) I307V probably benign Het
D17H6S53E A G 17: 35,346,512 (GRCm39) E141G probably benign Het
Ddias T C 7: 92,508,800 (GRCm39) T372A probably benign Het
Dffb T C 4: 154,049,976 (GRCm39) T296A probably damaging Het
Ep400 T C 5: 110,867,102 (GRCm39) Y1014C unknown Het
Ephx1 A G 1: 180,817,498 (GRCm39) I391T probably benign Het
Fcgbp A G 7: 27,800,701 (GRCm39) Y1249C probably damaging Het
Gm5592 T C 7: 40,807,052 (GRCm39) probably benign Het
Gm7964 A G 7: 83,405,629 (GRCm39) N149S probably benign Het
Greb1l T A 18: 10,542,380 (GRCm39) I1325N probably damaging Het
H2-T3 T C 17: 36,500,957 (GRCm39) T20A possibly damaging Het
Htr1d T C 4: 136,170,815 (GRCm39) I348T probably damaging Het
Hyal4 A T 6: 24,765,737 (GRCm39) S364C probably damaging Het
Igkv1-133 A T 6: 67,701,944 (GRCm39) Q16L probably benign Het
Irs2 C T 8: 11,057,643 (GRCm39) G263D probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kmt2a A G 9: 44,760,263 (GRCm39) Y529H probably damaging Het
Mdfic T A 6: 15,770,319 (GRCm39) N108K probably damaging Het
Met A T 6: 17,549,085 (GRCm39) D979V probably damaging Het
Mettl21e T A 1: 44,245,857 (GRCm39) I130F probably damaging Het
Mlh3 C T 12: 85,315,169 (GRCm39) C339Y probably damaging Het
Mog T C 17: 37,323,338 (GRCm39) H200R possibly damaging Het
Msrb3 C T 10: 120,620,103 (GRCm39) R72H probably damaging Het
Mtmr11 A G 3: 96,072,583 (GRCm39) H324R probably damaging Het
Myh7 T C 14: 55,210,838 (GRCm39) E1693G probably damaging Het
Nadk2 T A 15: 9,084,303 (GRCm39) W139R probably damaging Het
Ndufa9 A T 6: 126,821,362 (GRCm39) M76K possibly damaging Het
Nr1i2 A G 16: 38,086,269 (GRCm39) probably benign Het
Nsd3 A G 8: 26,152,835 (GRCm39) T392A probably damaging Het
Or14a259 A G 7: 86,013,308 (GRCm39) F79S probably benign Het
Or52d3 T C 7: 104,229,149 (GRCm39) S99P probably damaging Het
P2ry2 A T 7: 100,647,706 (GRCm39) S200T probably benign Het
Pcnt T A 10: 76,269,584 (GRCm39) E228V probably benign Het
Phka2 T A X: 159,327,291 (GRCm39) Y334* probably null Het
Pkhd1l1 A T 15: 44,390,265 (GRCm39) K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,429 (GRCm39) noncoding transcript Het
Rspry1 A G 8: 95,376,405 (GRCm39) D309G probably damaging Het
Scap A G 9: 110,209,271 (GRCm39) Y648C probably damaging Het
Sgcz T C 8: 38,420,201 (GRCm39) E17G probably damaging Het
Slc17a5 A T 9: 78,445,556 (GRCm39) V433D probably damaging Het
Smad9 C T 3: 54,696,705 (GRCm39) R257W probably damaging Het
Srcap T C 7: 127,141,319 (GRCm39) S1639P probably damaging Het
Strn3 T C 12: 51,707,999 (GRCm39) Y132C possibly damaging Het
Tas2r110 A T 6: 132,845,433 (GRCm39) M155L probably benign Het
Tasor2 T C 13: 3,645,556 (GRCm39) T98A probably benign Het
Thbd A G 2: 148,248,893 (GRCm39) V325A probably damaging Het
Trpd52l3 T A 19: 29,981,333 (GRCm39) C29* probably null Het
Trpm1 A G 7: 63,894,601 (GRCm39) Y951C probably damaging Het
Ube3a T A 7: 58,921,860 (GRCm39) N77K probably damaging Het
Upp2 G A 2: 58,680,128 (GRCm39) R300Q possibly damaging Het
Usp35 T C 7: 96,961,827 (GRCm39) H533R probably damaging Het
Veph1 C T 3: 66,122,858 (GRCm39) V224I probably benign Het
Vmn1r30 A T 6: 58,412,437 (GRCm39) F132I probably benign Het
Vmn2r24 A G 6: 123,792,997 (GRCm39) R775G probably damaging Het
Vps13c T A 9: 67,883,189 (GRCm39) probably null Het
Vps37c T A 19: 10,683,569 (GRCm39) probably null Het
Zap70 C T 1: 36,818,216 (GRCm39) T301I probably benign Het
Zfp341 A G 2: 154,466,801 (GRCm39) K57E probably damaging Het
Zfp60 T A 7: 27,448,753 (GRCm39) F474I probably benign Het
Zfp786 T C 6: 47,798,357 (GRCm39) N194D probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATCCCTGAGTCTAGTTCTCATTGAC -3'
(R):5'- GCCACGAAGTAAGCATCCAG -3'

Sequencing Primer
(F):5'- TGACAAATGAGAATCTTGACCCTC -3'
(R):5'- GTAAGCATCCAGATATTCACGCTG -3'
Posted On 2015-02-19