Incidental Mutation 'R3623:Btaf1'
ID268765
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36981086 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 668 (T668A)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: T668A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: T668A

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACGTGGTATTTCTGTGTTCAGCTC -3'
(R):5'- TCATGAATAGACAAGAGGTGGTTTG -3'

Sequencing Primer
(F):5'- GAGTGCCTTCATTAACTTTAGTTAGG -3'
(R):5'- GTCAAGAGAACTCTGCCTGCTAG -3'
Posted On2015-02-19