Mutagenetix > Incidental Mutation

Incidental Mutation 'R3691:Zfc3h1'

268786

Institutional Source

Beutler Lab

Gene Symbol

Zfc3h1

Ensembl Gene

ENSMUSG00000034163

Gene Name

zinc finger, C3H1-type containing

Synonyms

Ccdc131, Psrc2

MMRRC Submission

040686-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R3691 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115220864-115268677 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115256595 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1522 (T1522A)

Ref Sequence

ENSEMBL: ENSMUSP00000044069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036044]

AlphaFold

B2RT41

Predicted Effect

probably benign
Transcript: ENSMUST00000036044
AA Change: T1522A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: T1522A

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
low complexity region	29	90	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	143	214	N/A	INTRINSIC
coiled coil region	361	393	N/A	INTRINSIC
low complexity region	399	432	N/A	INTRINSIC
coiled coil region	436	491	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	564	583	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	623	636	N/A	INTRINSIC
low complexity region	716	729	N/A	INTRINSIC
low complexity region	752	763	N/A	INTRINSIC
coiled coil region	826	889	N/A	INTRINSIC
coiled coil region	968	1000	N/A	INTRINSIC
low complexity region	1001	1015	N/A	INTRINSIC
Pfam:zf-C3H1	1187	1208	1.3e-11	PFAM
HAT	1384	1416	1.11e0	SMART
HAT	1418	1449	4.35e2	SMART
Blast:HAT	1495	1538	2e-9	BLAST
HAT	1653	1685	3.31e1	SMART
HAT	1762	1797	7.03e1	SMART
HAT	1922	1954	1.29e-1	SMART
low complexity region	1975	1992	N/A	INTRINSIC

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (34/34)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	A	G	17: 14,108,671 (GRCm39)	E1398G	probably damaging	Het
Avl9	C	T	6: 56,713,812 (GRCm39)	H357Y	probably benign	Het
Best2	A	G	8: 85,737,883 (GRCm39)	F171L	probably benign	Het
Btbd19	A	T	4: 116,977,789 (GRCm39)		probably benign	Het
Cap1	A	G	4: 122,758,419 (GRCm39)	S254P	probably damaging	Het
Cfap43	G	A	19: 47,885,512 (GRCm39)	L368F	probably benign	Het
Clasrp	C	A	7: 19,319,165 (GRCm39)		probably benign	Het
Cog3	T	C	14: 75,991,878 (GRCm39)	M1V	probably null	Het
Drosha	G	A	15: 12,834,724 (GRCm39)	R276H	unknown	Het
Efr3b	T	A	12: 4,032,059 (GRCm39)	D183V	possibly damaging	Het
Epha1	T	C	6: 42,338,064 (GRCm39)	T794A	probably damaging	Het
Fbxo17	G	A	7: 28,436,887 (GRCm39)	V281I	probably damaging	Het
Flii	T	C	11: 60,610,583 (GRCm39)	Y571C	probably benign	Het
Flywch1	G	A	17: 23,982,186 (GRCm39)	P6L	probably damaging	Het
Foxj3	T	C	4: 119,473,839 (GRCm39)		probably benign	Het
Fras1	C	T	5: 96,929,371 (GRCm39)	T3925I	probably benign	Het
Gk5	T	C	9: 96,011,149 (GRCm39)		probably null	Het
Gm12588	T	G	11: 121,796,751 (GRCm39)	Q366P	possibly damaging	Het
Gm3248	A	G	14: 5,943,068 (GRCm38)	I161T	probably damaging	Het
Gzmg	T	A	14: 56,395,134 (GRCm39)		probably benign	Het
Lrrc69	A	T	4: 14,795,980 (GRCm39)	N22K	possibly damaging	Het
Med13l	A	G	5: 118,859,562 (GRCm39)	R250G	probably benign	Het
Mideas	C	T	12: 84,203,245 (GRCm39)	G886S	probably benign	Het
Mxi1	T	C	19: 53,358,062 (GRCm39)	L73P	probably damaging	Het
Myo9b	G	A	8: 71,786,981 (GRCm39)	R721Q	probably benign	Het
Napb	T	C	2: 148,544,977 (GRCm39)		probably null	Het
Nsun2	A	G	13: 69,760,456 (GRCm39)	N45D	probably damaging	Het
Or10ag2	T	C	2: 87,248,514 (GRCm39)	F39L	probably benign	Het
Oxct1	A	G	15: 4,076,999 (GRCm39)	M111V	probably benign	Het
Pcnx4	A	G	12: 72,620,493 (GRCm39)	D771G	probably damaging	Het
Serpina6	T	C	12: 103,620,668 (GRCm39)	D27G	probably benign	Het
Tecpr1	A	G	5: 144,146,797 (GRCm39)	F523S	probably benign	Het
Zan	A	G	5: 137,418,281 (GRCm39)	I2939T	unknown	Het

Other mutations in Zfc3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00698:Zfc3h1	APN	10	115,255,737 (GRCm39)	missense	possibly damaging	0.92
IGL00793:Zfc3h1	APN	10	115,252,779 (GRCm39)	missense	probably benign	0.00
IGL01349:Zfc3h1	APN	10	115,259,353 (GRCm39)	missense	probably damaging	1.00
IGL01431:Zfc3h1	APN	10	115,259,128 (GRCm39)	missense	possibly damaging	0.49
IGL02273:Zfc3h1	APN	10	115,263,004 (GRCm39)	missense	probably benign
IGL02382:Zfc3h1	APN	10	115,252,781 (GRCm39)	nonsense	probably null
IGL02397:Zfc3h1	APN	10	115,243,890 (GRCm39)	missense	probably damaging	1.00
IGL02657:Zfc3h1	APN	10	115,247,859 (GRCm39)	missense	possibly damaging	0.48
IGL02826:Zfc3h1	APN	10	115,236,809 (GRCm39)	missense	probably benign	0.42
Gnatcatcher	UTSW	10	115,236,647 (GRCm39)	missense	probably benign	0.39
hutton	UTSW	10	115,251,153 (GRCm39)	missense	probably damaging	0.96
passerine	UTSW	10	115,249,916 (GRCm39)	missense	possibly damaging	0.56
R0178_Zfc3h1_655	UTSW	10	115,242,630 (GRCm39)	splice site	probably benign
vireo	UTSW	10	115,255,806 (GRCm39)	missense	probably benign	0.01
warbler	UTSW	10	115,242,388 (GRCm39)	missense	probably damaging	1.00
PIT4260001:Zfc3h1	UTSW	10	115,226,794 (GRCm39)	missense	probably damaging	0.99
PIT4354001:Zfc3h1	UTSW	10	115,262,944 (GRCm39)	nonsense	probably null
R0062:Zfc3h1	UTSW	10	115,252,658 (GRCm39)	missense	probably benign	0.00
R0062:Zfc3h1	UTSW	10	115,252,658 (GRCm39)	missense	probably benign	0.00
R0067:Zfc3h1	UTSW	10	115,259,379 (GRCm39)	missense	possibly damaging	0.88
R0067:Zfc3h1	UTSW	10	115,259,379 (GRCm39)	missense	possibly damaging	0.88
R0104:Zfc3h1	UTSW	10	115,251,192 (GRCm39)	missense	possibly damaging	0.66
R0178:Zfc3h1	UTSW	10	115,242,630 (GRCm39)	splice site	probably benign
R0355:Zfc3h1	UTSW	10	115,245,018 (GRCm39)	missense	possibly damaging	0.80
R0619:Zfc3h1	UTSW	10	115,256,715 (GRCm39)	missense	possibly damaging	0.92
R0731:Zfc3h1	UTSW	10	115,246,537 (GRCm39)	missense	probably benign	0.00
R0828:Zfc3h1	UTSW	10	115,237,612 (GRCm39)	missense	possibly damaging	0.68
R0866:Zfc3h1	UTSW	10	115,263,621 (GRCm39)	missense	probably benign	0.00
R1196:Zfc3h1	UTSW	10	115,247,866 (GRCm39)	missense	probably damaging	0.99
R1455:Zfc3h1	UTSW	10	115,248,013 (GRCm39)	missense	probably benign	0.11
R1515:Zfc3h1	UTSW	10	115,252,647 (GRCm39)	missense	probably benign	0.29
R1617:Zfc3h1	UTSW	10	115,226,827 (GRCm39)	missense	probably benign	0.01
R1640:Zfc3h1	UTSW	10	115,242,806 (GRCm39)	splice site	probably null
R1959:Zfc3h1	UTSW	10	115,259,158 (GRCm39)	missense	probably benign	0.34
R2039:Zfc3h1	UTSW	10	115,242,388 (GRCm39)	missense	probably damaging	1.00
R3430:Zfc3h1	UTSW	10	115,246,428 (GRCm39)	splice site	probably benign
R3909:Zfc3h1	UTSW	10	115,255,806 (GRCm39)	missense	probably benign	0.01
R4235:Zfc3h1	UTSW	10	115,254,704 (GRCm39)	missense	probably benign	0.32
R4684:Zfc3h1	UTSW	10	115,259,290 (GRCm39)	missense	probably benign	0.03
R4816:Zfc3h1	UTSW	10	115,251,599 (GRCm39)	missense	probably benign	0.16
R4881:Zfc3h1	UTSW	10	115,236,647 (GRCm39)	missense	probably benign	0.39
R4883:Zfc3h1	UTSW	10	115,246,547 (GRCm39)	missense	probably damaging	1.00
R5038:Zfc3h1	UTSW	10	115,240,116 (GRCm39)	missense	probably benign	0.16
R5068:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5069:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5070:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5155:Zfc3h1	UTSW	10	115,248,026 (GRCm39)	missense	possibly damaging	0.64
R5190:Zfc3h1	UTSW	10	115,254,597 (GRCm39)	missense	probably damaging	1.00
R5499:Zfc3h1	UTSW	10	115,246,598 (GRCm39)	missense	probably damaging	1.00
R5932:Zfc3h1	UTSW	10	115,236,815 (GRCm39)	missense	probably benign	0.44
R5935:Zfc3h1	UTSW	10	115,267,262 (GRCm39)	intron	probably benign
R6165:Zfc3h1	UTSW	10	115,256,574 (GRCm39)	missense	probably benign	0.30
R6182:Zfc3h1	UTSW	10	115,226,764 (GRCm39)	missense	probably benign	0.00
R6262:Zfc3h1	UTSW	10	115,249,881 (GRCm39)	missense	probably damaging	1.00
R6382:Zfc3h1	UTSW	10	115,243,813 (GRCm39)	missense	probably benign	0.06
R6392:Zfc3h1	UTSW	10	115,237,653 (GRCm39)	missense	probably damaging	1.00
R6539:Zfc3h1	UTSW	10	115,247,907 (GRCm39)	missense	probably benign	0.26
R6723:Zfc3h1	UTSW	10	115,256,638 (GRCm39)	missense	probably benign	0.34
R7339:Zfc3h1	UTSW	10	115,239,205 (GRCm39)	missense	probably damaging	1.00
R7381:Zfc3h1	UTSW	10	115,260,535 (GRCm39)	missense	probably benign
R7404:Zfc3h1	UTSW	10	115,251,153 (GRCm39)	missense	probably damaging	0.96
R7667:Zfc3h1	UTSW	10	115,246,606 (GRCm39)	nonsense	probably null
R7748:Zfc3h1	UTSW	10	115,236,720 (GRCm39)	missense	probably benign	0.27
R7910:Zfc3h1	UTSW	10	115,256,588 (GRCm39)	nonsense	probably null
R7914:Zfc3h1	UTSW	10	115,239,062 (GRCm39)	splice site	probably null
R8023:Zfc3h1	UTSW	10	115,256,553 (GRCm39)	missense	probably damaging	1.00
R8169:Zfc3h1	UTSW	10	115,254,616 (GRCm39)	missense	probably damaging	0.98
R8358:Zfc3h1	UTSW	10	115,240,198 (GRCm39)	missense	probably benign	0.13
R8746:Zfc3h1	UTSW	10	115,243,885 (GRCm39)	missense	probably damaging	1.00
R8803:Zfc3h1	UTSW	10	115,247,800 (GRCm39)	missense	probably benign
R8905:Zfc3h1	UTSW	10	115,259,383 (GRCm39)	missense	probably benign	0.05
R9045:Zfc3h1	UTSW	10	115,263,319 (GRCm39)	missense	possibly damaging	0.49
R9164:Zfc3h1	UTSW	10	115,259,374 (GRCm39)	missense	probably benign	0.17
R9211:Zfc3h1	UTSW	10	115,248,328 (GRCm39)	missense	possibly damaging	0.83
R9216:Zfc3h1	UTSW	10	115,221,528 (GRCm39)	missense	unknown
R9305:Zfc3h1	UTSW	10	115,255,771 (GRCm39)	missense	probably benign	0.19
R9372:Zfc3h1	UTSW	10	115,221,223 (GRCm39)	missense	unknown
R9394:Zfc3h1	UTSW	10	115,254,600 (GRCm39)	missense	probably damaging	1.00
R9414:Zfc3h1	UTSW	10	115,249,916 (GRCm39)	missense	possibly damaging	0.56
R9538:Zfc3h1	UTSW	10	115,221,197 (GRCm39)	missense	unknown
R9623:Zfc3h1	UTSW	10	115,259,362 (GRCm39)	missense	possibly damaging	0.94
R9633:Zfc3h1	UTSW	10	115,247,852 (GRCm39)	missense	probably damaging	1.00
R9747:Zfc3h1	UTSW	10	115,244,821 (GRCm39)	missense	possibly damaging	0.58
Z1176:Zfc3h1	UTSW	10	115,243,907 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTCAGCACTTGGGAGG -3'
(R):5'- GCTAACAATAAGTCAGGATTGGTC -3'

Sequencing Primer
(F):5'- CTAAGGCTAGATGGAGAAACTCTGTC -3'
(R):5'- CAGGATTGGTCTTGACATCTTGAGC -3'

Posted On

2015-02-19