Incidental Mutation 'R3691:Efr3b'
ID268790
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
MMRRC Submission 040686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3691 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3982059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 183 (D183V)
Ref Sequence ENSEMBL: ENSMUSP00000151788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178] [ENSMUST00000218166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111178
AA Change: D299V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658
AA Change: D299V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217677
Predicted Effect possibly damaging
Transcript: ENSMUST00000218166
AA Change: D183V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220181
Meta Mutation Damage Score 0.4777 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Best2 A G 8: 85,011,254 F171L probably benign Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cfap43 G A 19: 47,897,073 L368F probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Drosha G A 15: 12,834,638 R276H unknown Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epha1 T C 6: 42,361,130 T794A probably damaging Het
Fbxo17 G A 7: 28,737,462 V281I probably damaging Het
Flii T C 11: 60,719,757 Y571C probably benign Het
Flywch1 G A 17: 23,763,212 P6L probably damaging Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fras1 C T 5: 96,781,512 T3925I probably benign Het
Gk5 T C 9: 96,129,096 probably null Het
Gm12588 T G 11: 121,905,925 Q366P possibly damaging Het
Gm3248 A G 14: 5,943,068 I161T probably damaging Het
Gzmg T A 14: 56,157,677 probably benign Het
Lrrc69 A T 4: 14,795,980 N22K possibly damaging Het
Med13l A G 5: 118,721,497 R250G probably benign Het
Mxi1 T C 19: 53,369,631 L73P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Napb T C 2: 148,703,057 probably null Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1123 T C 2: 87,418,170 F39L probably benign Het
Oxct1 A G 15: 4,047,517 M111V probably benign Het
Pcnx4 A G 12: 72,573,719 D771G probably damaging Het
Serpina6 T C 12: 103,654,409 D27G probably benign Het
Tecpr1 A G 5: 144,209,979 F523S probably benign Het
Zan A G 5: 137,420,019 I2939T unknown Het
Zfc3h1 A G 10: 115,420,690 T1522A probably benign Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 splice site probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0782:Efr3b UTSW 12 3984686 splice site probably benign
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R2359:Efr3b UTSW 12 3980136 unclassified probably benign
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5819:Efr3b UTSW 12 3992965 missense probably benign 0.21
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R6969:Efr3b UTSW 12 3968624 missense probably benign 0.08
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
R8071:Efr3b UTSW 12 3982898 missense probably benign 0.02
R8686:Efr3b UTSW 12 4000886 missense probably damaging 1.00
R8737:Efr3b UTSW 12 3999594 missense probably damaging 1.00
R8942:Efr3b UTSW 12 3982091 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGAGGGACCCACAAATCATG -3'
(R):5'- AGATTCCCTGGGATTTGGCTC -3'

Sequencing Primer
(F):5'- TGCTCTCCCGTAAGCCCAG -3'
(R):5'- TTGTTGTTTGGGGACCAGCACGT -3'
Posted On2015-02-19